9-121299868-CCGCACCGCCCCGCGCCCGCGCTGCTTTG-C
Variant summary
Our verdict is Uncertain significance. The variant received 3 ACMG points: 4P and 1B. PVS1_StrongBP6
The ENST00000373818.8(GSN):c.11_38delACCGCCCCGCGCCCGCGCTGCTTTGCGC(p.His4ArgfsTer86) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000102 in 1,332,012 control chromosomes in the GnomAD database, including 1 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
ENST00000373818.8 frameshift
Scores
Clinical Significance
Conservation
Publications
- Finnish type amyloidosisInheritance: AD, AR Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 3 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.000178 AC: 27AN: 151924Hom.: 0 Cov.: 31 show subpopulations
GnomAD2 exomes AF: 0.00 AC: 0AN: 55316 AF XY: 0.00
GnomAD4 exome AF: 0.0000924 AC: 109AN: 1179978Hom.: 1 AF XY: 0.000103 AC XY: 59AN XY: 574868 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000178 AC: 27AN: 152034Hom.: 0 Cov.: 31 AF XY: 0.000283 AC XY: 21AN XY: 74332 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not provided Uncertain:1Benign:1
- -
- -
Finnish type amyloidosis Uncertain:1
The frameshift p.His4ArgfsTer86 variant in the GSN gene has not been reported previously as a pathogenic variant nor as a benign variant, to our knowledge. The p.His4ArgfsTer86 variant is novel (not in any individuals) in 1000 Genomes. The variant is poorly covered in the gnomAD database and hence frequency estimates are not reliable. This variant causes a frameshift starting with codon Histidine 4, changes this amino acid to Arginine residue, and creates a premature Stop codon at position 86 of the new reading frame, denoted p.His4ArgfsTer86. For these reasons, this variant has been classified as Uncertain Significance -
Inborn genetic diseases Benign:1
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at