rs764841269

Variant names:

• chr9-121299868-CCGCACCGCCCCGCGCCCGCGCTGCTTTG-C
• rs764841269
• ENST00000373818.8:c.11_38delACCGCCCCGCGCCCGCGCTGCTTTGCGC

Variant summary

Our verdict is Likely benign. Variant got -1 ACMG points: 4P and 5B. PVS1_Strong BP6 BS2

The NM_000177.5(GSN):​c.11_38delACCGCCCCGCGCCCGCGCTGCTTTGCGC​(p.His4ArgfsTer86) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000102 in 1,332,012 control chromosomes in the GnomAD database, including 1 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00018 (0 hom., cov: 31)
  • Exomes 𝑓: 0.000092 (1 hom.)
• Consequence: GSN NM_000177.5 frameshift
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:2
• Conservation: PhyloP100: 2.55

Genes affected

GSN (HGNC:4620): (gelsolin) The protein encoded by this gene binds to the "plus" ends of actin monomers and filaments to prevent monomer exchange. The encoded calcium-regulated protein functions in both assembly and disassembly of actin filaments. Defects in this gene are a cause of familial amyloidosis Finnish type (FAF). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_benign. Variant got -1 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 4 pathogenic variants in the truncated region.
• BP6: Variant 9-121299868-CCGCACCGCCCCGCGCCCGCGCTGCTTTG-C is Benign according to our data. Variant chr9-121299868-CCGCACCGCCCCGCGCCCGCGCTGCTTTG-C is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 591908.We mark this variant Likely_benign, oryginal submissions are: {Likely_benign=1, Benign=1, Uncertain_significance=1}.
• BS2: High AC in GnomAd4 at 27 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
GSN	NM_198252.3	c.-9-2091_-9-2064delACCGCCCCGCGCCCGCGCTGCTTTGCGC		intron_variant	Intron 2 of 17	ENST00000432226.7	NP_937895.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
GSN	ENST00000432226.7	c.-9-2091_-9-2064delACCGCCCCGCGCCCGCGCTGCTTTGCGC		intron_variant	Intron 2 of 17	5	NM_198252.3	ENSP00000404226.2

Frequencies

GnomAD3 genomes AF: 0.000178 AC: 27 AN: 151924 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00447

Gnomad SAS AF: 0.000828

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000924 AC: 109 AN: 1179978 Hom.: 1 AF XY: 0.000103 AC XY: 59 AN XY: 574868

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00364

Gnomad4 SAS exome AF: 0.000179

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000104

Gnomad4 OTH exome AF: 0.000171

GnomAD4 genome AF: 0.000178 AC: 27 AN: 152034 Hom.: 0 Cov.: 31 AF XY: 0.000283 AC XY: 21 AN XY: 74332

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00449

Gnomad4 SAS AF: 0.000828

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

Alfa AF: 0.000169 Hom.: 0

Bravo AF: 0.000227

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:2 Benign:2

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:1 Benign:1

Sep 09, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Sep 16, 2018

Gharavi Laboratory, Columbia University

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: research

- -

Finnish type amyloidosis Uncertain:1

-

Neuberg Centre For Genomic Medicine, NCGM

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The frameshift p.His4ArgfsTer86 variant in the GSN gene has not been reported previously as a pathogenic variant nor as a benign variant, to our knowledge. The p.His4ArgfsTer86 variant is novel (not in any individuals) in 1000 Genomes. The variant is poorly covered in the gnomAD database and hence frequency estimates are not reliable. This variant causes a frameshift starting with codon Histidine 4, changes this amino acid to Arginine residue, and creates a premature Stop codon at position 86 of the new reading frame, denoted p.His4ArgfsTer86. For these reasons, this variant has been classified as Uncertain Significance -

Inborn genetic diseases Benign:1

Oct 25, 2019

Ambry Genetics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs764841269; hg19: chr9-124062146;