9-132905830-GGAGTGAAGATACTGGTCTCCA-C

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4PP3

The NM_000368.5(TSC1):​c.1727_1748delTGGAGACCAGTATCTTCACTCCinsG​(p.Leu576_Pro583delinsCys) variant causes a missense, disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars). Synonymous variant affecting the same amino acid position (i.e. L576L) has been classified as Benign.

Frequency

Genomes: not found (cov: 32)

Consequence

TSC1
NM_000368.5 missense, disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

not provided no classification provided O:1

Conservation

PhyloP100: 9.36

Publications

0 publications found
Variant links:
Genes affected
TSC1 (HGNC:12362): (TSC complex subunit 1) This gene is a tumor suppressor gene that encodes the growth inhibitory protein hamartin. The encoded protein interacts with and stabilizes the GTPase activating protein tuberin. This hamartin-tuberin complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. This protein also functions as a co-chaperone for Hsp90 that inhibits its ATPase activity. This protein functions as a facilitator of Hsp90-mediated folding of kinase and non-kinase clients, including TSC2 and thereby preventing their ubiquitination and proteasomal degradation. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]
TSC1 Gene-Disease associations (from GenCC):
  • tuberous sclerosis
    Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
  • tuberous sclerosis 1
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, PanelApp Australia, Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae)
  • lung lymphangioleiomyomatosis
    Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
  • tuberous sclerosis complex
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_000368.5.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TSC1NM_000368.5 linkc.1727_1748delTGGAGACCAGTATCTTCACTCCinsG p.Leu576_Pro583delinsCys missense_variant, disruptive_inframe_deletion Exon 15 of 23 ENST00000298552.9 NP_000359.1 Q92574-1Q86WV8X5D9D2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TSC1ENST00000298552.9 linkc.1727_1748delTGGAGACCAGTATCTTCACTCCinsG p.Leu576_Pro583delinsCys missense_variant, disruptive_inframe_deletion Exon 15 of 23 1 NM_000368.5 ENSP00000298552.3 Q92574-1
TSC1ENST00000490179.4 linkc.1727_1748delTGGAGACCAGTATCTTCACTCCinsG p.Leu576_Pro583delinsCys missense_variant, disruptive_inframe_deletion Exon 16 of 24 3 ENSP00000495533.2 A0A2R8Y6S8

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: not provided
Submissions summary: Other:1
Revision: no classification provided
LINK: link

Submissions by phenotype

Malignant tumor of urinary bladder Other:1
-
Tuberous sclerosis database (TSC1)
Significance:not provided
Review Status:no classification provided
Collection Method:curation

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs118203569; hg19: chr9-135781217; COSMIC: COSV53764954; API