rs118203569

Variant names:

• chr9-132905830-GGAGTGAAGATACTGGTCTCCA-C
• rs118203569
• NM_000368.5:c.1727_1748delTGGAGACCAGTATCTTCACTCCinsG

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP3

The NM_000368.5(TSC1):​c.1727_1748delTGGAGACCAGTATCTTCACTCCinsG​(p.Leu576_Pro583delinsCys) variant causes a missense, disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as not provided (no stars). Another nucleotide change resulting in the same amino acid substitution has been previously reported as Pathogenic in Lovd. Synonymous variant affecting the same amino acid position (i.e. L576L) has been classified as Benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: TSC1 NM_000368.5 missense, disruptive_inframe_deletion
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 9.36

Genes affected

TSC1 (HGNC:12362): (TSC complex subunit 1) This gene is a tumor suppressor gene that encodes the growth inhibitory protein hamartin. The encoded protein interacts with and stabilizes the GTPase activating protein tuberin. This hamartin-tuberin complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. This protein also functions as a co-chaperone for Hsp90 that inhibits its ATPase activity. This protein functions as a facilitator of Hsp90-mediated folding of kinase and non-kinase clients, including TSC2 and thereby preventing their ubiquitination and proteasomal degradation. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000368.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TSC1	NM_000368.5	c.1727_1748delTGGAGACCAGTATCTTCACTCCinsG	p.Leu576_Pro583delinsCys	missense_variant, disruptive_inframe_deletion	Exon 15 of 23	ENST00000298552.9	NP_000359.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TSC1	ENST00000298552.9	c.1727_1748delTGGAGACCAGTATCTTCACTCCinsG	p.Leu576_Pro583delinsCys	missense_variant, disruptive_inframe_deletion	Exon 15 of 23	1	NM_000368.5	ENSP00000298552.3
TSC1	ENST00000490179.4	c.1727_1748delTGGAGACCAGTATCTTCACTCCinsG	p.Leu576_Pro583delinsCys	missense_variant, disruptive_inframe_deletion	Exon 16 of 24	3		ENSP00000495533.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: not provided

Submissions summary: Other:1

Revision: no classification provided

Submissions by phenotype

Malignant tumor of urinary bladder Other:1

-

Tuberous sclerosis database (TSC1)

Significance: not provided

Review Status: no classification provided

Collection Method: curation

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs118203569; hg19: chr9-135781217; COSMIC: COSV53764954; COSMIC: COSV53764954;