Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2PM4PP2PP3
The NM_000368.5(TSC1):c.1727_1748delTGGAGACCAGTATCTTCACTCCinsG(p.Leu576_Pro583delinsCys) variant causes a missense, disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as not provided (no stars). Another nucleotide change resulting in same amino acid change has been previously reported as Pathogenicin Lovd. Synonymous variant affecting the same amino acid position (i.e. L576L) has been classified as Benign.
TSC1 (HGNC:12362): (TSC complex subunit 1) This gene is a tumor suppressor gene that encodes the growth inhibitory protein hamartin. The encoded protein interacts with and stabilizes the GTPase activating protein tuberin. This hamartin-tuberin complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. This protein also functions as a co-chaperone for Hsp90 that inhibits its ATPase activity. This protein functions as a facilitator of Hsp90-mediated folding of kinase and non-kinase clients, including TSC2 and thereby preventing their ubiquitination and proteasomal degradation. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]
Verdict is Likely_pathogenic. Variant got 6 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000368.5.
PP2
Missense variant in gene, where missense usually causes diseases (based on misZ statistic), TSC1. . Gene score misZ 2.3217 (greater than the threshold 3.09). Trascript score misZ 3.6986 (greater than threshold 3.09). GenCC has associacion of gene with lung lymphangioleiomyomatosis, tuberous sclerosis 1, tuberous sclerosis, tuberous sclerosis complex, lymphangioleiomyomatosis.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP