rs118203569

Variant names:

• chr9-132905830-GGAGTGAAGATACTGGTCTCCA-C
• rs118203569
• NM_000368.5:c.1727_1748delTGGAGACCAGTATCTTCACTCCinsG

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP3

The NM_000368.5(TSC1):​c.1727_1748delTGGAGACCAGTATCTTCACTCCinsG​(p.Leu576_Pro583delinsCys) variant causes a missense, disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars). Synonymous variant affecting the same amino acid position (i.e. L576L) has been classified as Benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: TSC1 NM_000368.5 missense, disruptive_inframe_deletion
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 9.36
• Publications: 0 publications found

Genes affected

TSC1 (HGNC:12362): (TSC complex subunit 1) This gene is a tumor suppressor gene that encodes the growth inhibitory protein hamartin. The encoded protein interacts with and stabilizes the GTPase activating protein tuberin. This hamartin-tuberin complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. This protein also functions as a co-chaperone for Hsp90 that inhibits its ATPase activity. This protein functions as a facilitator of Hsp90-mediated folding of kinase and non-kinase clients, including TSC2 and thereby preventing their ubiquitination and proteasomal degradation. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

TSC1 Gene-Disease associations (from GenCC):

• tuberous sclerosis

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• tuberous sclerosis 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, PanelApp Australia, Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae)
• lung lymphangioleiomyomatosis

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• tuberous sclerosis complex

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000368.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000368.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TSC1	NM_000368.5	MANE Select	c.1727_1748delTGGAGACCAGTATCTTCACTCCinsG	p.Leu576_Pro583delinsCys	missense disruptive_inframe_deletion	Exon 15 of 23	NP_000359.1
	TSC1	NM_001406592.1		c.1727_1748delTGGAGACCAGTATCTTCACTCCinsG	p.Leu576_Pro583delinsCys	missense disruptive_inframe_deletion	Exon 15 of 23	NP_001393521.1
	TSC1	NM_001406593.1		c.1727_1748delTGGAGACCAGTATCTTCACTCCinsG	p.Leu576_Pro583delinsCys	missense disruptive_inframe_deletion	Exon 15 of 23	NP_001393522.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TSC1	ENST00000298552.9	TSL:1 MANE Select	c.1727_1748delTGGAGACCAGTATCTTCACTCCinsG	p.Leu576_Pro583delinsCys	missense disruptive_inframe_deletion	Exon 15 of 23	ENSP00000298552.3
	TSC1	ENST00000490179.4	TSL:3	c.1727_1748delTGGAGACCAGTATCTTCACTCCinsG	p.Leu576_Pro583delinsCys	missense disruptive_inframe_deletion	Exon 16 of 24	ENSP00000495533.2
	TSC1	ENST00000643875.1		c.1727_1748delTGGAGACCAGTATCTTCACTCCinsG	p.Leu576_Pro583delinsCys	missense disruptive_inframe_deletion	Exon 15 of 23	ENSP00000495158.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: not provided

Submissions summary: Other:1

Revision: no classification provided

Submissions by phenotype

Malignant tumor of urinary bladder Other:1

Tuberous sclerosis database (TSC1)

Significance: not provided

Review Status: no classification provided

Collection Method: curation

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs118203569; hg19: chr9-135781217; COSMIC: COSV53764954;