9-132905875-C-CCCGCAGGGCTTTCATCAGCACTG

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_000368.5(TSC1):​c.1680_1702dupCAGTGCTGATGAAAGCCCTGCGG​(p.Gly568AlafsTer69) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

TSC1
NM_000368.5 frameshift

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2O:1

Conservation

PhyloP100: 1.95
Variant links:
Genes affected
TSC1 (HGNC:12362): (TSC complex subunit 1) This gene is a tumor suppressor gene that encodes the growth inhibitory protein hamartin. The encoded protein interacts with and stabilizes the GTPase activating protein tuberin. This hamartin-tuberin complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. This protein also functions as a co-chaperone for Hsp90 that inhibits its ATPase activity. This protein functions as a facilitator of Hsp90-mediated folding of kinase and non-kinase clients, including TSC2 and thereby preventing their ubiquitination and proteasomal degradation. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 9-132905875-C-CCCGCAGGGCTTTCATCAGCACTG is Pathogenic according to our data. Variant chr9-132905875-C-CCCGCAGGGCTTTCATCAGCACTG is described in ClinVar as [Likely_pathogenic]. Clinvar id is 48813.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TSC1NM_000368.5 linkc.1680_1702dupCAGTGCTGATGAAAGCCCTGCGG p.Gly568AlafsTer69 frameshift_variant Exon 15 of 23 ENST00000298552.9 NP_000359.1 Q92574-1Q86WV8X5D9D2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TSC1ENST00000298552.9 linkc.1680_1702dupCAGTGCTGATGAAAGCCCTGCGG p.Gly568AlafsTer69 frameshift_variant Exon 15 of 23 1 NM_000368.5 ENSP00000298552.3 Q92574-1
TSC1ENST00000490179.4 linkc.1680_1702dupCAGTGCTGATGAAAGCCCTGCGG p.Gly568AlafsTer69 frameshift_variant Exon 16 of 24 3 ENSP00000495533.2 A0A2R8Y6S8

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
32
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:2Other:1
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

not provided Pathogenic:1
Apr 17, 2023
Clinical Genetics Laboratory, Skane University Hospital Lund
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Tuberous sclerosis 1 Pathogenic:1
Sep 25, 2020
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Gly568Alafs*69) in the TSC1 gene. It is expected to result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). This variant has been observed in individual(s) with tuberous sclerosis complex (PMID: 10340649, 16114042). In at least one individual the variant was observed to be de novo. ClinVar contains an entry for this variant (Variation ID: 48813). Loss-of-function variants in TSC1 are known to be pathogenic (PMID: 10227394, 17304050). For these reasons, this variant has been classified as Pathogenic. -

Tuberous sclerosis syndrome Other:1
-
Tuberous sclerosis database (TSC1)
Significance: not provided
Review Status: no classification provided
Collection Method: curation

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs118203557; hg19: chr9-135781262; API