rs118203557

Variant names:

• chr9-132905875-CCCGCAGGGCTTTCATCAGCACTG-C
• rs118203557
• NM_000368.5:c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG

Your query was ambiguous. Multiple possible variants found:

• chr9-132905875-CCCGCAGGGCTTTCATCAGCACTG-C
• chr9-132905875-CCCGCAGGGCTTTCATCAGCACTG-CCCGCAGGGCTTTCATCAGCACTGCCGCAGGGCTTTCATCAGCACTG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000368.5(TSC1):​c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG​(p.Ser561ArgfsTer19) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G560G) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: TSC1 NM_000368.5 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:4 O:2
• Conservation: PhyloP100: 5.69
• Publications: 3 publications found

Genes affected

TSC1 (HGNC:12362): (TSC complex subunit 1) This gene is a tumor suppressor gene that encodes the growth inhibitory protein hamartin. The encoded protein interacts with and stabilizes the GTPase activating protein tuberin. This hamartin-tuberin complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. This protein also functions as a co-chaperone for Hsp90 that inhibits its ATPase activity. This protein functions as a facilitator of Hsp90-mediated folding of kinase and non-kinase clients, including TSC2 and thereby preventing their ubiquitination and proteasomal degradation. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

TSC1 Gene-Disease associations (from GenCC):

• tuberous sclerosis

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• tuberous sclerosis 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, PanelApp Australia, Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae)
• lung lymphangioleiomyomatosis

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• tuberous sclerosis complex

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 9-132905875-CCCGCAGGGCTTTCATCAGCACTG-C is Pathogenic according to our data. Variant chr9-132905875-CCCGCAGGGCTTTCATCAGCACTG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 64763.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TSC1	NM_000368.5	c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG	p.Ser561ArgfsTer19	frameshift_variant	Exon 15 of 23	ENST00000298552.9	NP_000359.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TSC1	ENST00000298552.9	c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG	p.Ser561ArgfsTer19	frameshift_variant	Exon 15 of 23	1	NM_000368.5	ENSP00000298552.3
TSC1	ENST00000490179.4	c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG	p.Ser561ArgfsTer19	frameshift_variant	Exon 16 of 24	3		ENSP00000495533.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:4 Other:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Tuberous sclerosis 1 Pathogenic:3

Nov 07, 2021

Genome-Nilou Lab

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

May 29, 2018

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant has been reported in an individual in the Leiden Open-source Variation Database (PMID: 21520333). ClinVar contains an entry for this variant (Variation ID: 64763). This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Ser561Argfs*19) in the TSC1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in TSC1 are known to be pathogenic (PMID: 10227394, 17304050). For these reasons, this variant has been classified as Pathogenic.

Jun 04, 1999

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

Tuberous sclerosis syndrome Other:2

Tuberous sclerosis database (TSC1)

Significance: not provided

Review Status: no classification provided

Collection Method: curation

Tuberous sclerosis database (TSC1)

Significance: not provided

Review Status: no classification provided

Collection Method: curation

not provided Pathogenic:1

Dec 12, 2017

Athena Diagnostics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.7
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs118203557; hg19: chr9-135781262; COSMIC: COSV99036925; COSMIC: COSV99036925;