rs118203557
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000368.5(TSC1):c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG(p.Ser561ArgfsTer19) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G560G) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000368.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- tuberous sclerosisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- tuberous sclerosis 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, PanelApp Australia, Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae)
- lung lymphangioleiomyomatosisInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- tuberous sclerosis complexInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| TSC1 | NM_000368.5 | c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG | p.Ser561ArgfsTer19 | frameshift_variant | Exon 15 of 23 | ENST00000298552.9 | NP_000359.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| TSC1 | ENST00000298552.9 | c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG | p.Ser561ArgfsTer19 | frameshift_variant | Exon 15 of 23 | 1 | NM_000368.5 | ENSP00000298552.3 | ||
| TSC1 | ENST00000490179.4 | c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG | p.Ser561ArgfsTer19 | frameshift_variant | Exon 16 of 24 | 3 | ENSP00000495533.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Tuberous sclerosis 1 Pathogenic:3
This variant has been reported in an individual in the Leiden Open-source Variation Database (PMID: 21520333). ClinVar contains an entry for this variant (Variation ID: 64763). This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Ser561Argfs*19) in the TSC1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in TSC1 are known to be pathogenic (PMID: 10227394, 17304050). For these reasons, this variant has been classified as Pathogenic.
Tuberous sclerosis syndrome Other:2
not provided Pathogenic:1
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at