9-132905875-CCCGCAGGGCTTTCATCAGCACTG-CCCGCAGGGCTTTCATCAGCACTGCCGCAGGGCTTTCATCAGCACTG
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_000368.5(TSC1):c.1680_1702dupCAGTGCTGATGAAAGCCCTGCGG(p.Gly568fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 32)
Consequence
TSC1
NM_000368.5 frameshift
NM_000368.5 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 1.95
Genes affected
TSC1 (HGNC:12362): (TSC complex subunit 1) This gene is a tumor suppressor gene that encodes the growth inhibitory protein hamartin. The encoded protein interacts with and stabilizes the GTPase activating protein tuberin. This hamartin-tuberin complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. This protein also functions as a co-chaperone for Hsp90 that inhibits its ATPase activity. This protein functions as a facilitator of Hsp90-mediated folding of kinase and non-kinase clients, including TSC2 and thereby preventing their ubiquitination and proteasomal degradation. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 18 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 9-132905875-C-CCCGCAGGGCTTTCATCAGCACTG is Pathogenic according to our data. Variant chr9-132905875-C-CCCGCAGGGCTTTCATCAGCACTG is described in ClinVar as [Likely_pathogenic]. Clinvar id is 48813.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
TSC1 | NM_000368.5 | c.1680_1702dupCAGTGCTGATGAAAGCCCTGCGG | p.Gly568fs | frameshift_variant | 15/23 | ENST00000298552.9 | NP_000359.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
TSC1 | ENST00000298552.9 | c.1680_1702dupCAGTGCTGATGAAAGCCCTGCGG | p.Gly568fs | frameshift_variant | 15/23 | 1 | NM_000368.5 | ENSP00000298552.3 | ||
TSC1 | ENST00000490179.4 | c.1680_1702dupCAGTGCTGATGAAAGCCCTGCGG | p.Gly568fs | frameshift_variant | 16/24 | 3 | ENSP00000495533.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
GnomAD4 exome Cov.: 32
GnomAD4 exome
Cov.:
32
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:2Other:1
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
not provided Pathogenic:1
Likely pathogenic, criteria provided, single submitter | clinical testing | Clinical Genetics Laboratory, Skane University Hospital Lund | Apr 17, 2023 | - - |
Tuberous sclerosis 1 Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Sep 25, 2020 | For these reasons, this variant has been classified as Pathogenic. Loss-of-function variants in TSC1 are known to be pathogenic (PMID: 10227394, 17304050). This variant has been observed in individual(s) with tuberous sclerosis complex (PMID: 10340649, 16114042). In at least one individual the variant was observed to be de novo. ClinVar contains an entry for this variant (Variation ID: 48813). This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Gly568Alafs*69) in the TSC1 gene. It is expected to result in an absent or disrupted protein product. - |
Tuberous sclerosis syndrome Other:1
not provided, no classification provided | curation | Tuberous sclerosis database (TSC1) | - | - - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at