9-135784482-GCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCC-GCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCC

Variant names:

• chr9-135784482-G-GCTCCCTCCCTCCCTCC
• rs55843930
• NM_020822.3:c.2944-22_2944-7dupCCCTCCCTCCCTCCCT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_020822.3(KCNT1):​c.2944-22_2944-7dupCCCTCCCTCCCTCCCT variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAdExome4), which may indicate mosaicism or somatic mutations in the reference population data. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00022 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00056 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: KCNT1 NM_020822.3 splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.164
• Publications: 0 publications found

Genes affected

KCNT1 (HGNC:18865): (potassium sodium-activated channel subfamily T member 1) Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a sodium-activated potassium channel subunit which is thought to function in ion conductance and developmental signaling pathways. Mutations in this gene cause the early-onset epileptic disorders, malignant migrating partial seizures of infancy and autosomal dominant nocturnal frontal lobe epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]

KCNT1 Gene-Disease associations (from GenCC):

• childhood-onset epilepsy syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• developmental and epileptic encephalopathy, 14

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
• malignant migrating partial seizures of infancy

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• autosomal dominant nocturnal frontal lobe epilepsy 5

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• autosomal dominant nocturnal frontal lobe epilepsy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_020822.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNT1	NM_020822.3	MANE Select	c.2944-22_2944-7dupCCCTCCCTCCCTCCCT		splice_region intron	N/A	NP_065873.2
	KCNT1	NM_001272003.2		c.2809-22_2809-7dupCCCTCCCTCCCTCCCT		splice_region intron	N/A	NP_001258932.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNT1	ENST00000371757.7	TSL:1 MANE Select	c.2944-22_2944-7dupCCCTCCCTCCCTCCCT		splice_region intron	N/A	ENSP00000360822.2
	KCNT1	ENST00000460750.5	TSL:1	n.*2554-22_*2554-7dupCCCTCCCTCCCTCCCT		splice_region intron	N/A	ENSP00000418777.1
	KCNT1	ENST00000487664.5	TSL:5	c.2944-22_2944-7dupCCCTCCCTCCCTCCCT		splice_region intron	N/A	ENSP00000417851.2

Frequencies

GnomAD3 genomes AF: 0.000221 AC: 15 AN: 67752 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000141

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00104

Gnomad SAS AF: 0.000585

Gnomad FIN AF: 0.00121

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000202

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000562 AC: 221 AN: 393346 Hom.: 0 Cov.: 0 AF XY: 0.000541 AC XY: 113 AN XY: 208998

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000525 AC: 6 AN: 11420

American (AMR) AF: 0.000301 AC: 7 AN: 23270

Ashkenazi Jewish (ASJ) AF: 0.0000713 AC: 1 AN: 14030

East Asian (EAS) AF: 0.000686 AC: 16 AN: 23328

South Asian (SAS) AF: 0.0000649 AC: 3 AN: 46190

European-Finnish (FIN) AF: 0.000469 AC: 14 AN: 29846

Middle Eastern (MID) AF: 0.00115 AC: 2 AN: 1740

European-Non Finnish (NFE) AF: 0.000731 AC: 162 AN: 221564

Other (OTH) AF: 0.000455 AC: 10 AN: 21958

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.000221 AC: 15 AN: 67812 Hom.: 0 Cov.: 0 AF XY: 0.000223 AC XY: 7 AN XY: 31406

African (AFR) AF: 0.00 AC: 0 AN: 15548

American (AMR) AF: 0.000141 AC: 1 AN: 7092

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2188

East Asian (EAS) AF: 0.00104 AC: 2 AN: 1916

South Asian (SAS) AF: 0.000587 AC: 1 AN: 1704

European-Finnish (FIN) AF: 0.00121 AC: 4 AN: 3312

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 122

European-Non Finnish (NFE) AF: 0.000202 AC: 7 AN: 34642

Other (OTH) AF: 0.00 AC: 0 AN: 896

Alfa AF: 0.00 Hom.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.16

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs55843930; hg19: chr9-138676328;