9-135784482-GCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCC-GCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCC

Variant names:

• chr9-135784482-G-GCTCCCTCCCTCCCTCC
• rs55843930
• NM_020822.3:c.2944-22_2944-7dupCCCTCCCTCCCTCCCT

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BS1 BS2

The NM_020822.3(KCNT1):​c.2944-22_2944-7dupCCCTCCCTCCCTCCCT variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00022 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00056 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: KCNT1 NM_020822.3 splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.164

Genes affected

KCNT1 (HGNC:18865): (potassium sodium-activated channel subfamily T member 1) Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a sodium-activated potassium channel subunit which is thought to function in ion conductance and developmental signaling pathways. Mutations in this gene cause the early-onset epileptic disorders, malignant migrating partial seizures of infancy and autosomal dominant nocturnal frontal lobe epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BS1: Variant frequency is greater than expected in population mid. gnomad4_exome allele frequency = 0.000562 (221/393346) while in subpopulation MID AF= 0.00115 (2/1740). AF 95% confidence interval is 0.000639. There are 0 homozygotes in gnomad4_exome. There are 113 alleles in male gnomad4_exome subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High AC in GnomAdExome4 at 221 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KCNT1	NM_020822.3	c.2944-22_2944-7dupCCCTCCCTCCCTCCCT		splice_region_variant, intron_variant	Intron 25 of 30	ENST00000371757.7	NP_065873.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KCNT1	ENST00000371757.7	c.2944-53_2944-52insCTCCCTCCCTCCCTCC		intron_variant	Intron 25 of 30	1	NM_020822.3	ENSP00000360822.2

Frequencies

GnomAD3 genomes AF: 0.00 AC: 15 AN: 67752 Hom.: 0 Cov.: 0 FAILED QC

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000141

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00104

Gnomad SAS AF: 0.000585

Gnomad FIN AF: 0.00121

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000202

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000562 AC: 221 AN: 393346 Hom.: 0 Cov.: 0 AF XY: 0.000541 AC XY: 113 AN XY: 208998

Gnomad4 AFR exome AF: 0.000525

Gnomad4 AMR exome AF: 0.000301

Gnomad4 ASJ exome AF: 0.0000713

Gnomad4 EAS exome AF: 0.000686

Gnomad4 SAS exome AF: 0.0000649

Gnomad4 FIN exome AF: 0.000469

Gnomad4 NFE exome AF: 0.000731

Gnomad4 OTH exome AF: 0.000455

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.000221 AC: 15 AN: 67812 Hom.: 0 Cov.: 0 AF XY: 0.000223 AC XY: 7 AN XY: 31406

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.000141

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00104

Gnomad4 SAS AF: 0.000587

Gnomad4 FIN AF: 0.00121

Gnomad4 NFE AF: 0.000202

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs55843930; hg19: chr9-138676328;