9-135786170-CGCCCTGCCCTGCCCT-CGCCCTGCCCTGCCCTGCCCTGCCCTGCCCTGCCCT
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_020822.3(KCNT1):c.3178-22_3178-3dupTGCCCTGCCCTGCCCTGCCC variant causes a splice acceptor, intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_020822.3 splice_acceptor, intron
Scores
Clinical Significance
Conservation
Publications
- childhood-onset epilepsy syndromeInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- developmental and epileptic encephalopathy, 14Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
- malignant migrating partial seizures of infancyInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
- autosomal dominant nocturnal frontal lobe epilepsy 5Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- autosomal dominant nocturnal frontal lobe epilepsyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_020822.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KCNT1 | TSL:1 MANE Select | c.3178-22_3178-3dupTGCCCTGCCCTGCCCTGCCC | splice_acceptor intron | N/A | ENSP00000360822.2 | Q5JUK3-3 | |||
| KCNT1 | TSL:1 | n.*2788-22_*2788-3dupTGCCCTGCCCTGCCCTGCCC | splice_acceptor intron | N/A | ENSP00000418777.1 | F8WC49 | |||
| KCNT1 | TSL:5 | c.3178-22_3178-3dupTGCCCTGCCCTGCCCTGCCC | splice_acceptor intron | N/A | ENSP00000417851.2 | Q5JUK3-2 |
Frequencies
GnomAD3 genomes AF: 0.00000664 AC: 1AN: 150528Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 7.15e-7 AC: 1AN: 1397656Hom.: 0 Cov.: 12 AF XY: 0.00000144 AC XY: 1AN XY: 696472 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome AF: 0.00000664 AC: 1AN: 150528Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0AN XY: 73462 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at