chr9-135786170-C-CGCCCTGCCCTGCCCTGCCCT

Variant names:

• chr9-135786170-C-CGCCCTGCCCTGCCCTGCCCT
• rs757968008
• NM_020822.3:c.3178-22_3178-3dupTGCCCTGCCCTGCCCTGCCC

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_020822.3(KCNT1):​c.3178-22_3178-3dupTGCCCTGCCCTGCCCTGCCC variant causes a splice acceptor, intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 0)
  • Exomes 𝑓: 7.2e-7 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: KCNT1 NM_020822.3 splice_acceptor, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.600
• Publications: 1 publications found

Genes affected

KCNT1 (HGNC:18865): (potassium sodium-activated channel subfamily T member 1) Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a sodium-activated potassium channel subunit which is thought to function in ion conductance and developmental signaling pathways. Mutations in this gene cause the early-onset epileptic disorders, malignant migrating partial seizures of infancy and autosomal dominant nocturnal frontal lobe epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]

KCNT1 Gene-Disease associations (from GenCC):

• childhood-onset epilepsy syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• developmental and epileptic encephalopathy, 14

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• malignant migrating partial seizures of infancy

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• autosomal dominant nocturnal frontal lobe epilepsy 5

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• autosomal dominant nocturnal frontal lobe epilepsy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KCNT1	NM_020822.3	c.3178-22_3178-3dupTGCCCTGCCCTGCCCTGCCC		splice_acceptor_variant, intron_variant	Intron 28 of 30	ENST00000371757.7	NP_065873.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KCNT1	ENST00000371757.7	c.3178-22_3178-3dupTGCCCTGCCCTGCCCTGCCC		splice_acceptor_variant, intron_variant	Intron 28 of 30	1	NM_020822.3	ENSP00000360822.2

Frequencies

GnomAD3 genomes AF: 0.00000664 AC: 1 AN: 150528 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 7.15e-7 AC: 1 AN: 1397656 Hom.: 0 Cov.: 12 AF XY: 0.00000144 AC XY: 1 AN XY: 696472

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 30560

American (AMR) AF: 0.00 AC: 0 AN: 38862

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25146

East Asian (EAS) AF: 0.00 AC: 0 AN: 38614

South Asian (SAS) AF: 0.00 AC: 0 AN: 81936

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 50462

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5596

European-Non Finnish (NFE) AF: 9.36e-7 AC: 1 AN: 1068486

Other (OTH) AF: 0.00 AC: 0 AN: 57994

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00000664 AC: 1 AN: 150528 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 73462

African (AFR) AF: 0.00 AC: 0 AN: 40634

American (AMR) AF: 0.00 AC: 0 AN: 15190

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3466

East Asian (EAS) AF: 0.00 AC: 0 AN: 5080

South Asian (SAS) AF: 0.00 AC: 0 AN: 4748

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10472

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000148 AC: 1 AN: 67656

Other (OTH) AF: 0.00 AC: 0 AN: 2064

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.60

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs757968008; hg19: chr9-138678016;