9-136199657-AGCGTCGTCCCCTCGGCTGACCTC-A

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1PM2PP5

The NM_178138.6(LHX3):​c.452_454+20delGAGGTCAGCCGAGGGGACGACGC​(p.Arg151_Glu152delinsGln) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

Frequency

Genomes: not found (cov: 34)

Consequence

LHX3
NM_178138.6 splice_donor, disruptive_inframe_deletion, splice_region, intron

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:2

Conservation

PhyloP100: 0.472
Variant links:
Genes affected
LHX3 (HGNC:6595): (LIM homeobox 3) This gene encodes a member of a large family of proteins which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor that is required for pituitary development and motor neuron specification. Mutations in this gene cause combined pituitary hormone deficiency 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 11 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 9-136199657-AGCGTCGTCCCCTCGGCTGACCTC-A is Pathogenic according to our data. Variant chr9-136199657-AGCGTCGTCCCCTCGGCTGACCTC-A is described in ClinVar as [Pathogenic]. Clinvar id is 9022.Status of the report is no_assertion_criteria_provided, 0 stars. Variant chr9-136199657-AGCGTCGTCCCCTCGGCTGACCTC-A is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
LHX3NM_178138.6 linkuse as main transcriptc.452_454+20delGAGGTCAGCCGAGGGGACGACGC p.Arg151_Glu152delinsGln splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant 3/6 ENST00000371748.10 NP_835258.1 Q9UBR4-1F1T0D5
LHX3NM_014564.5 linkuse as main transcriptc.467_469+20delGAGGTCAGCCGAGGGGACGACGC p.Arg156_Glu157delinsGln splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant 3/6 NP_055379.1 Q9UBR4-2F1T0D9
LHX3NM_001363746.1 linkuse as main transcriptc.419_421+20delGAGGTCAGCCGAGGGGACGACGC p.Arg140_Glu141delinsGln splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant 3/6 NP_001350675.1
LHX3XM_017015168.1 linkuse as main transcriptc.380_382+20delGAGGTCAGCCGAGGGGACGACGC p.Arg127_Glu128delinsGln splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant 3/6 XP_016870657.1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
LHX3ENST00000371748.10 linkuse as main transcriptc.452_454+20delGAGGTCAGCCGAGGGGACGACGC p.Arg151_Glu152delinsGln splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant 3/61 NM_178138.6 ENSP00000360813.4 Q9UBR4-1
LHX3ENST00000371746.9 linkuse as main transcriptc.467_469+20delGAGGTCAGCCGAGGGGACGACGC p.Arg156_Glu157delinsGln splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant 3/61 ENSP00000360811.3 Q9UBR4-2
LHX3ENST00000619587.1 linkuse as main transcriptc.419_421+20delGAGGTCAGCCGAGGGGACGACGC p.Arg140_Glu141delinsGln splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant 3/61 ENSP00000483080.1 F1T0D7
LHX3ENST00000645419.1 linkuse as main transcriptn.1277_1279+20delGAGGTCAGCCGAGGGGACGACGC splice_donor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant 2/5

Frequencies

GnomAD3 genomes
Cov.:
34
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
34

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Non-acquired combined pituitary hormone deficiency with spine abnormalities Pathogenic:2
Pathogenic, no assertion criteria providedliterature onlyOMIMJul 15, 2008- -
Pathogenic, no assertion criteria providedcurationDepartment Of Genetics, Sultan Qaboos University Hospital, Sultan Qaboos UniversityDec 30, 2017- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs587776711; hg19: chr9-139091503; API