rs587776711

Variant names:

• chr9-136199657-AGCGTCGTCCCCTCGGCTGACCTC-A
• rs587776711
• NM_178138.6:c.452_454+20delGAGGTCAGCCGAGGGGACGACGC

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_178138.6(LHX3):​c.452_454+20delGAGGTCAGCCGAGGGGACGACGC​(p.Arg151_Glu152delinsGln) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. R151R) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 34)
• Consequence: LHX3 NM_178138.6 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:2
• Conservation: PhyloP100: 0.472
• Publications: 0 publications found

Genes affected

LHX3 (HGNC:6595): (LIM homeobox 3) This gene encodes a member of a large family of proteins which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor that is required for pituitary development and motor neuron specification. Mutations in this gene cause combined pituitary hormone deficiency 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

LHX3 Gene-Disease associations (from GenCC):

• non-acquired combined pituitary hormone deficiency with spine abnormalities

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae), PanelApp Australia
• hypothyroidism due to deficient transcription factors involved in pituitary development or function

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PP5: Variant 9-136199657-AGCGTCGTCCCCTCGGCTGACCTC-A is Pathogenic according to our data. Variant chr9-136199657-AGCGTCGTCCCCTCGGCTGACCTC-A is described in ClinVar as Pathogenic. ClinVar VariationId is 9022.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LHX3	NM_178138.6	c.452_454+20delGAGGTCAGCCGAGGGGACGACGC	p.Arg151_Glu152delinsGln	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 3 of 6	ENST00000371748.10	NP_835258.1
LHX3	NM_014564.5	c.467_469+20delGAGGTCAGCCGAGGGGACGACGC	p.Arg156_Glu157delinsGln	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 3 of 6		NP_055379.1
LHX3	NM_001363746.1	c.419_421+20delGAGGTCAGCCGAGGGGACGACGC	p.Arg140_Glu141delinsGln	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 3 of 6		NP_001350675.1
LHX3	XM_017015168.1	c.380_382+20delGAGGTCAGCCGAGGGGACGACGC	p.Arg127_Glu128delinsGln	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 3 of 6		XP_016870657.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LHX3	ENST00000371748.10	c.452_454+20delGAGGTCAGCCGAGGGGACGACGC	p.Arg151_Glu152delinsGln	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 3 of 6	1	NM_178138.6	ENSP00000360813.4
LHX3	ENST00000371746.9	c.467_469+20delGAGGTCAGCCGAGGGGACGACGC	p.Arg156_Glu157delinsGln	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 3 of 6	1		ENSP00000360811.3
LHX3	ENST00000619587.1	c.419_421+20delGAGGTCAGCCGAGGGGACGACGC	p.Arg140_Glu141delinsGln	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 3 of 6	1		ENSP00000483080.1
LHX3	ENST00000645419.1	n.1277_1279+20delGAGGTCAGCCGAGGGGACGACGC		splice_donor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	Exon 2 of 5

Frequencies

GnomAD3 genomes Cov.: 34

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 34

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: no assertion criteria provided

Submissions by phenotype

Non-acquired combined pituitary hormone deficiency with spine abnormalities Pathogenic:2

Dec 30, 2017

Department Of Genetics, Sultan Qaboos University Hospital, Sultan Qaboos University

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: curation

- -

Jul 15, 2008

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.47
Mutation Taster		=4/196	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587776711; hg19: chr9-139091503;