9-2039776-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAG
Variant summary
Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP3BP6BS1BS2
The NM_003070.5(SMARCA2):c.684_707delGCAGCAGCAGCAGCAGCAGCAGCA(p.Gln229_Gln236del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000439 in 1,596,348 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_003070.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- intellectual disability-sparse hair-brachydactyly syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -10 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| SMARCA2 | NM_003070.5 | c.684_707delGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln229_Gln236del | disruptive_inframe_deletion | Exon 4 of 34 | ENST00000349721.8 | NP_003061.3 | |
| SMARCA2 | NM_001289396.2 | c.684_707delGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln229_Gln236del | disruptive_inframe_deletion | Exon 4 of 34 | NP_001276325.1 | ||
| SMARCA2 | NM_139045.4 | c.684_707delGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln229_Gln236del | disruptive_inframe_deletion | Exon 4 of 33 | NP_620614.2 | ||
| SMARCA2 | NM_001289397.2 | c.684_707delGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln229_Gln236del | disruptive_inframe_deletion | Exon 4 of 33 | NP_001276326.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| SMARCA2 | ENST00000349721.8 | c.684_707delGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln229_Gln236del | disruptive_inframe_deletion | Exon 4 of 34 | 5 | NM_003070.5 | ENSP00000265773.5 |
Frequencies
GnomAD3 genomes AF: 0.0000598 AC: 9AN: 150432Hom.: 0 Cov.: 26 show subpopulations
GnomAD4 exome AF: 0.0000422 AC: 61AN: 1445816Hom.: 0 AF XY: 0.0000334 AC XY: 24AN XY: 718570 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000598 AC: 9AN: 150532Hom.: 0 Cov.: 26 AF XY: 0.0000680 AC XY: 5AN XY: 73486 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not specified Uncertain:1
not provided Uncertain:1
Inborn genetic diseases Benign:1
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at