chr9-2039776-ACAGCAGCAGCAGCAGCAGCAGCAG-A

Variant names:

• chr9-2039776-ACAGCAGCAGCAGCAGCAGCAGCAG-A
• rs113070757
• NM_003070.5:c.684_707delGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. Variant got -9 ACMG points: 0P and 9B. BP6 BS1 BS2

The NM_003070.5(SMARCA2):​c.684_707delGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln229_Gln236del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000439 in 1,596,348 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.000060 (0 hom., cov: 26)
  • Exomes 𝑓: 0.000042 (0 hom.)
• Consequence: SMARCA2 NM_003070.5 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:1
• Conservation: PhyloP100: 1.94

Genes affected

SMARCA2 (HGNC:11098): (SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2) The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]

ACMG classification

Verdict is Benign. Variant got -9 ACMG points.

• BP6: Variant 9-2039776-ACAGCAGCAGCAGCAGCAGCAGCAG-A is Benign according to our data. Variant chr9-2039776-ACAGCAGCAGCAGCAGCAGCAGCAG-A is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 436801.We mark this variant Likely_benign, oryginal submissions are: {Uncertain_significance=2, Likely_benign=1}.
• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.0000598 (9/150532) while in subpopulation AFR AF= 0.000147 (6/40908). AF 95% confidence interval is 0.0000635. There are 0 homozygotes in gnomad4. There are 5 alleles in male gnomad4 subpopulation. Median coverage is 26. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 9 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SMARCA2	NM_003070.5	c.684_707delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln229_Gln236del	disruptive_inframe_deletion	Exon 4 of 34	ENST00000349721.8	NP_003061.3
SMARCA2	NM_001289396.2	c.684_707delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln229_Gln236del	disruptive_inframe_deletion	Exon 4 of 34		NP_001276325.1
SMARCA2	NM_139045.4	c.684_707delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln229_Gln236del	disruptive_inframe_deletion	Exon 4 of 33		NP_620614.2
SMARCA2	NM_001289397.2	c.684_707delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln229_Gln236del	disruptive_inframe_deletion	Exon 4 of 33		NP_001276326.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SMARCA2	ENST00000349721.8	c.684_707delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln229_Gln236del	disruptive_inframe_deletion	Exon 4 of 34	5	NM_003070.5	ENSP00000265773.5

Frequencies

GnomAD3 genomes AF: 0.0000598 AC: 9 AN: 150432 Hom.: 0 Cov.: 26

Gnomad AFR AF: 0.000147

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000662

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000296

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000422 AC: 61 AN: 1445816 Hom.: 0 AF XY: 0.0000334 AC XY: 24 AN XY: 718570

Gnomad4 AFR exome AF: 0.000122

Gnomad4 AMR exome AF: 0.000187

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000520

Gnomad4 SAS exome AF: 0.000141

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000281

Gnomad4 OTH exome AF: 0.0000670

GnomAD4 genome AF: 0.0000598 AC: 9 AN: 150532 Hom.: 0 Cov.: 26 AF XY: 0.0000680 AC XY: 5 AN XY: 73486

Gnomad4 AFR AF: 0.000147

Gnomad4 AMR AF: 0.0000661

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000296

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:2 Benign:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not specified Uncertain:1

Feb 02, 2017

Genetic Services Laboratory, University of Chicago

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Uncertain:1

-

Breakthrough Genomics, Breakthrough Genomics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: not provided

- -

Inborn genetic diseases Benign:1

Aug 08, 2019

Ambry Genetics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs113070757; hg19: chr9-2039776;