9-22006052-CCACGGGCAGACGACCCCAGGCATCGCG-C

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2PM4PP3

The NM_004936.4(CDKN2B):​c.325_351delCGCGATGCCTGGGGTCGTCTGCCCGTG​(p.Arg109_Val117del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

CDKN2B
NM_004936.4 conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 8.95
Variant links:
Genes affected
CDKN2B (HGNC:1788): (cyclin dependent kinase inhibitor 2B) This gene lies adjacent to the tumor suppressor gene CDKN2A in a region that is frequently mutated and deleted in a wide variety of tumors. This gene encodes a cyclin-dependent kinase inhibitor, which forms a complex with CDK4 or CDK6, and prevents the activation of the CDK kinases, thus the encoded protein functions as a cell growth regulator that controls cell cycle G1 progression. The expression of this gene was found to be dramatically induced by TGF beta, which suggested its role in the TGF beta induced growth inhibition. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
CDKN2B-AS1 (HGNC:34341): (CDKN2B antisense RNA 1) This gene is located within the CDKN2B-CDKN2A gene cluster at chromosome 9p21. The gene product is a functional RNA molecule that interacts with polycomb repressive complex-1 (PRC1) and -2 (PRC2), leading to epigenetic silencing of other genes in this cluster. This region is a significant genetic susceptibility locus for cardiovascular disease, and has also been linked to a number of other pathologies, including several cancers, intracranial aneurysm, type-2 diabetes, periodontitis, Alzheimer's disease, endometriosis, frailty in the elderly, and glaucoma. Multiple alternatively processed transcript variants have been detected, some of which may take the form of circular RNA molecules (PMID:21151960). [provided by RefSeq, May 2014]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 5 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_004936.4.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CDKN2BNM_004936.4 linkc.325_351delCGCGATGCCTGGGGTCGTCTGCCCGTG p.Arg109_Val117del conservative_inframe_deletion Exon 2 of 2 ENST00000276925.7 NP_004927.2 P42772-1K7PPU3

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CDKN2BENST00000276925.7 linkc.325_351delCGCGATGCCTGGGGTCGTCTGCCCGTG p.Arg109_Val117del conservative_inframe_deletion Exon 2 of 2 1 NM_004936.4 ENSP00000276925.6 P42772-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not specified Uncertain:1
Mar 04, 2025
Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr9-22006051; API