9-2621884-T-TCCCTCCTCTCCCCTTGCCTC

Variant names:

• chr9-2621884-T-TCCCTCCTCTCCCCTTGCCTC
• rs539873248
• NM_003383.5:c.-296_-277dupCCCCTTGCCTCCCCTCCTCT

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_Moderate BS1 BS2

The NM_003383.5(VLDLR):​c.-296_-277dupCCCCTTGCCTCCCCTCCTCT variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0014 in 597,922 control chromosomes in the GnomAD database, including 12 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.00057 (0 hom., cov: 31)
  • Exomes 𝑓: 0.0017 (12 hom.)
• Consequence: VLDLR NM_003383.5 5_prime_UTR
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: -0.211
• Publications: 1 publications found

Genes affected

VLDLR (HGNC:12698): (very low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]

VLDLR-AS1 (HGNC:49621): (VLDLR antisense RNA 1)

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP6: Variant 9-2621884-T-TCCCTCCTCTCCCCTTGCCTC is Benign according to our data. Variant chr9-2621884-T-TCCCTCCTCTCCCCTTGCCTC is described in ClinVar as Likely_benign. ClinVar VariationId is 2659036.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS1: Variant frequency is greater than expected in population sas. GnomAd4 allele frequency = 0.000574 (87/151626) while in subpopulation SAS AF = 0.00733 (35/4776). AF 95% confidence interval is 0.00542. There are 0 homozygotes in GnomAd4. There are 53 alleles in the male GnomAd4 subpopulation. Median coverage is 31. This position passed quality control check.
• BS2: High Homozygotes in GnomAdExome4 at 12 AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003383.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	VLDLR	NM_003383.5	MANE Select	c.-296_-277dupCCCCTTGCCTCCCCTCCTCT		5_prime_UTR	Exon 1 of 19	NP_003374.3
	VLDLR	NM_001018056.3		c.-296_-277dupCCCCTTGCCTCCCCTCCTCT		5_prime_UTR	Exon 1 of 18	NP_001018066.1	P98155-2
	VLDLR	NM_001322225.2		c.-296_-277dupCCCCTTGCCTCCCCTCCTCT		5_prime_UTR	Exon 1 of 18	NP_001309154.1	A0A7P0T897

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	VLDLR	ENST00000382100.8	TSL:1 MANE Select	c.-296_-277dupCCCCTTGCCTCCCCTCCTCT		5_prime_UTR	Exon 1 of 19	ENSP00000371532.2	P98155-1
	VLDLR-AS1	ENST00000453601.5	TSL:1	n.274+196_274+215dupGAGGCAAGGGGAGAGGAGGG		intron	N/A
	VLDLR	ENST00000947327.1		c.-296_-277dupCCCCTTGCCTCCCCTCCTCT		5_prime_UTR	Exon 1 of 19	ENSP00000617386.1

Frequencies

GnomAD3 genomes AF: 0.000581 AC: 88 AN: 151514 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.0000727

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000197

Gnomad ASJ AF: 0.000866

Gnomad EAS AF: 0.000196

Gnomad SAS AF: 0.00732

Gnomad FIN AF: 0.0000952

Gnomad MID AF: 0.00316

Gnomad NFE AF: 0.000531

Gnomad OTH AF: 0.00239

GnomAD2 exomes AF: 0.00170 AC: 218 AN: 128164 AF XY: 0.00215

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000690

Gnomad ASJ exome AF: 0.000373

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.000184

Gnomad NFE exome AF: 0.000335

Gnomad OTH exome AF: 0.00103

GnomAD4 exome AF: 0.00168 AC: 750 AN: 446296 Hom.: 12 Cov.: 0 AF XY: 0.00224 AC XY: 550 AN XY: 245114

African (AFR) AF: 0.0000791 AC: 1 AN: 12648

American (AMR) AF: 0.000612 AC: 19 AN: 31060

Ashkenazi Jewish (ASJ) AF: 0.000245 AC: 4 AN: 16320

East Asian (EAS) AF: 0.00 AC: 0 AN: 22776

South Asian (SAS) AF: 0.00947 AC: 570 AN: 60186

European-Finnish (FIN) AF: 0.0000818 AC: 2 AN: 24460

Middle Eastern (MID) AF: 0.00417 AC: 8 AN: 1918

European-Non Finnish (NFE) AF: 0.000447 AC: 113 AN: 252852

Other (OTH) AF: 0.00137 AC: 33 AN: 24076

GnomAD4 genome AF: 0.000574 AC: 87 AN: 151626 Hom.: 0 Cov.: 31 AF XY: 0.000715 AC XY: 53 AN XY: 74140

African (AFR) AF: 0.0000725 AC: 3 AN: 41380

American (AMR) AF: 0.000197 AC: 3 AN: 15264

Ashkenazi Jewish (ASJ) AF: 0.000866 AC: 3 AN: 3464

East Asian (EAS) AF: 0.000197 AC: 1 AN: 5078

South Asian (SAS) AF: 0.00733 AC: 35 AN: 4776

European-Finnish (FIN) AF: 0.0000952 AC: 1 AN: 10508

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.000531 AC: 36 AN: 67842

Other (OTH) AF: 0.00237 AC: 5 AN: 2112

Alfa AF: 0.000474 Hom.: 0

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.21
Mutation Taster		=300/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs539873248; hg19: chr9-2621884;