9-99105187-AGGCGGTGGCGGCGGGACCATGGAGGC-A

Variant names:

• chr9-99105187-AGGCGGTGGCGGCGGGACCATGGAGGC-A
• NM_004612.4:c.-12_14delGGCGGCGGGACCATGGAGGCGGCGGT

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_004612.4(TGFBR1):​c.-12_14delGGCGGCGGGACCATGGAGGCGGCGGT​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: TGFBR1 NM_004612.4 frameshift, start_lost
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.34

Genes affected

TGFBR1 (HGNC:11772): (transforming growth factor beta receptor 1) The protein encoded by this gene forms a heteromeric complex with type II TGF-beta receptors when bound to TGF-beta, transducing the TGF-beta signal from the cell surface to the cytoplasm. The encoded protein is a serine/threonine protein kinase. Mutations in this gene have been associated with Loeys-Dietz aortic aneurysm syndrome (LDAS). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 39 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TGFBR1	NM_004612.4	c.-12_14delGGCGGCGGGACCATGGAGGCGGCGGT	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 9	ENST00000374994.9	NP_004603.1
TGFBR1	NM_004612.4	c.-12_14delGGCGGCGGGACCATGGAGGCGGCGGT		5_prime_UTR_variant	Exon 1 of 9	ENST00000374994.9	NP_004603.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TGFBR1	ENST00000374994.9	c.-12_14delGGCGGCGGGACCATGGAGGCGGCGGT	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 9	1	NM_004612.4	ENSP00000364133.4
TGFBR1	ENST00000374994	c.-12_14delGGCGGCGGGACCATGGAGGCGGCGGT		5_prime_UTR_variant	Exon 1 of 9	1	NM_004612.4	ENSP00000364133.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Familial thoracic aortic aneurysm and aortic dissection Uncertain:1

Jan 11, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change affects the initiator methionine of the TGFBR1 mRNA. The next in-frame methionine is located at codon 70. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. Disruption of the initiator codon has been observed in individual(s) with clinical features of TGFBR1-related conditions (Invitae). ClinVar contains an entry for this variant (Variation ID: 1363743). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant disrupts a region of the TGFBR1 protein in which other variant(s) (p.Ala3Thr) have been observed in individuals with TGFBR1-related conditions (Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr9-101867469;