9-99105187-AGGCGGTGGCGGCGGGACCATGGAGGC-A
Variant summary
Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PM2
The NM_004612.4(TGFBR1):c.-12_14delGGCGGCGGGACCATGGAGGCGGCGGT(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 32)
Consequence
TGFBR1
NM_004612.4 frameshift, start_lost
NM_004612.4 frameshift, start_lost
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 2.34
Genes affected
TGFBR1 (HGNC:11772): (transforming growth factor beta receptor 1) The protein encoded by this gene forms a heteromeric complex with type II TGF-beta receptors when bound to TGF-beta, transducing the TGF-beta signal from the cell surface to the cytoplasm. The encoded protein is a serine/threonine protein kinase. Mutations in this gene have been associated with Loeys-Dietz aortic aneurysm syndrome (LDAS). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 10 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 39 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
TGFBR1 | NM_004612.4 | c.-12_14delGGCGGCGGGACCATGGAGGCGGCGGT | p.Met1fs | frameshift_variant, start_lost | 1/9 | ENST00000374994.9 | NP_004603.1 | |
TGFBR1 | NM_004612.4 | c.-12_14delGGCGGCGGGACCATGGAGGCGGCGGT | 5_prime_UTR_variant | 1/9 | ENST00000374994.9 | NP_004603.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
TGFBR1 | ENST00000374994.9 | c.-12_14delGGCGGCGGGACCATGGAGGCGGCGGT | p.Met1fs | frameshift_variant, start_lost | 1/9 | 1 | NM_004612.4 | ENSP00000364133.4 | ||
TGFBR1 | ENST00000374994 | c.-12_14delGGCGGCGGGACCATGGAGGCGGCGGT | 5_prime_UTR_variant | 1/9 | 1 | NM_004612.4 | ENSP00000364133.4 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Familial thoracic aortic aneurysm and aortic dissection Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jan 11, 2024 | This sequence change affects the initiator methionine of the TGFBR1 mRNA. The next in-frame methionine is located at codon 70. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. Disruption of the initiator codon has been observed in individual(s) with clinical features of TGFBR1-related conditions (Invitae). ClinVar contains an entry for this variant (Variation ID: 1363743). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant disrupts a region of the TGFBR1 protein in which other variant(s) (p.Ala3Thr) have been observed in individuals with TGFBR1-related conditions (Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.