chr9-99105187-AGGCGGTGGCGGCGGGACCATGGAGGC-A

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PM2

The NM_004612.4(TGFBR1):​c.-12_14delGGCGGCGGGACCATGGAGGCGGCGGT​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

TGFBR1
NM_004612.4 frameshift, start_lost

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 2.34
Variant links:
Genes affected
TGFBR1 (HGNC:11772): (transforming growth factor beta receptor 1) The protein encoded by this gene forms a heteromeric complex with type II TGF-beta receptors when bound to TGF-beta, transducing the TGF-beta signal from the cell surface to the cytoplasm. The encoded protein is a serine/threonine protein kinase. Mutations in this gene have been associated with Loeys-Dietz aortic aneurysm syndrome (LDAS). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 10 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 39 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
TGFBR1NM_004612.4 linkuse as main transcriptc.-12_14delGGCGGCGGGACCATGGAGGCGGCGGT p.Met1fs frameshift_variant, start_lost 1/9 ENST00000374994.9 NP_004603.1 P36897-1Q5T7S2B4DXN7
TGFBR1NM_004612.4 linkuse as main transcriptc.-12_14delGGCGGCGGGACCATGGAGGCGGCGGT 5_prime_UTR_variant 1/9 ENST00000374994.9 NP_004603.1 P36897-1Q5T7S2B4DXN7

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
TGFBR1ENST00000374994.9 linkuse as main transcriptc.-12_14delGGCGGCGGGACCATGGAGGCGGCGGT p.Met1fs frameshift_variant, start_lost 1/91 NM_004612.4 ENSP00000364133.4 P36897-1
TGFBR1ENST00000374994 linkuse as main transcriptc.-12_14delGGCGGCGGGACCATGGAGGCGGCGGT 5_prime_UTR_variant 1/91 NM_004612.4 ENSP00000364133.4 P36897-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Familial thoracic aortic aneurysm and aortic dissection Uncertain:1
Uncertain significance, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpJan 11, 2024This sequence change affects the initiator methionine of the TGFBR1 mRNA. The next in-frame methionine is located at codon 70. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. Disruption of the initiator codon has been observed in individual(s) with clinical features of TGFBR1-related conditions (Invitae). ClinVar contains an entry for this variant (Variation ID: 1363743). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant disrupts a region of the TGFBR1 protein in which other variant(s) (p.Ala3Thr) have been observed in individuals with TGFBR1-related conditions (Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr9-101867469; API