9-99105206-A-ATGGAGGCGGCGGTCGCTGCTCCGCG

Variant names:

• chr9-99105206-A-ATGGAGGCGGCGGTCGCTGCTCCGCG
• NM_004612.4:c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_004612.4(TGFBR1):​c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT​(p.Pro10GlyfsTer73) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: TGFBR1 NM_004612.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: -0.334
• Publications: 0 publications found

Genes affected

TGFBR1 (HGNC:11772): (transforming growth factor beta receptor 1) The protein encoded by this gene forms a heteromeric complex with type II TGF-beta receptors when bound to TGF-beta, transducing the TGF-beta signal from the cell surface to the cytoplasm. The encoded protein is a serine/threonine protein kinase. Mutations in this gene have been associated with Loeys-Dietz aortic aneurysm syndrome (LDAS). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]

TGFBR1 Gene-Disease associations (from GenCC):

• familial thoracic aortic aneurysm and aortic dissection

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• Loeys-Dietz syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• Loeys-Dietz syndrome 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, PanelApp Australia, Genomics England PanelApp, G2P
• multiple self-healing squamous epithelioma

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 119 pathogenic variants in the truncated region.
• PP5: Variant 9-99105206-A-ATGGAGGCGGCGGTCGCTGCTCCGCG is Pathogenic according to our data. Variant chr9-99105206-A-ATGGAGGCGGCGGTCGCTGCTCCGCG is described in ClinVar as [Pathogenic]. Clinvar id is 2748941.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TGFBR1	NM_004612.4	c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT	p.Pro10GlyfsTer73	frameshift_variant	Exon 1 of 9	ENST00000374994.9	NP_004603.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TGFBR1	ENST00000374994.9	c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT	p.Pro10GlyfsTer73	frameshift_variant	Exon 1 of 9	1	NM_004612.4	ENSP00000364133.4

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Familial thoracic aortic aneurysm and aortic dissection Pathogenic:1

Aug 08, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Pro10Glyfs*73) in the TGFBR1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in TGFBR1 are known to be pathogenic (PMID: 21358634). The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with TGFBR1-related conditions. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.33
Mutation Taster		=17/183	disease causing

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr9-101867488;