NM_004612.4:c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_004612.4(TGFBR1):​c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT​(p.Pro10GlyfsTer73) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

TGFBR1
NM_004612.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: -0.334

Publications

0 publications found
Variant links:
Genes affected
TGFBR1 (HGNC:11772): (transforming growth factor beta receptor 1) The protein encoded by this gene forms a heteromeric complex with type II TGF-beta receptors when bound to TGF-beta, transducing the TGF-beta signal from the cell surface to the cytoplasm. The encoded protein is a serine/threonine protein kinase. Mutations in this gene have been associated with Loeys-Dietz aortic aneurysm syndrome (LDAS). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
TGFBR1 Gene-Disease associations (from GenCC):
  • familial thoracic aortic aneurysm and aortic dissection
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
  • Loeys-Dietz syndrome
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
  • Loeys-Dietz syndrome 1
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, PanelApp Australia, Genomics England PanelApp, G2P
  • multiple self-healing squamous epithelioma
    Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 119 pathogenic variants in the truncated region.
PP5
Variant 9-99105206-A-ATGGAGGCGGCGGTCGCTGCTCCGCG is Pathogenic according to our data. Variant chr9-99105206-A-ATGGAGGCGGCGGTCGCTGCTCCGCG is described in ClinVar as [Pathogenic]. Clinvar id is 2748941.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TGFBR1NM_004612.4 linkc.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT p.Pro10GlyfsTer73 frameshift_variant Exon 1 of 9 ENST00000374994.9 NP_004603.1 P36897-1Q5T7S2B4DXN7

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TGFBR1ENST00000374994.9 linkc.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT p.Pro10GlyfsTer73 frameshift_variant Exon 1 of 9 1 NM_004612.4 ENSP00000364133.4 P36897-1

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
30
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Familial thoracic aortic aneurysm and aortic dissection Pathogenic:1
Aug 08, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change creates a premature translational stop signal (p.Pro10Glyfs*73) in the TGFBR1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in TGFBR1 are known to be pathogenic (PMID: 21358634). The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with TGFBR1-related conditions. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
-0.33
Mutation Taster
=17/183
disease causing

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

hg19: chr9-101867488; API