NM_004612.4:c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_004612.4(TGFBR1):c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT(p.Pro10GlyfsTer73) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_004612.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- familial thoracic aortic aneurysm and aortic dissectionInheritance: AD, Unknown Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- Loeys-Dietz syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- Loeys-Dietz syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
- multiple self-healing squamous epitheliomaInheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: G2P, ClinGen, Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004612.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TGFBR1 | NM_004612.4 | MANE Select | c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT | p.Pro10GlyfsTer73 | frameshift | Exon 1 of 9 | NP_004603.1 | P36897-1 | |
| TGFBR1 | NM_001306210.2 | c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT | p.Pro10GlyfsTer73 | frameshift | Exon 1 of 9 | NP_001293139.1 | P36897-2 | ||
| TGFBR1 | NM_001407416.1 | c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT | p.Pro10GlyfsTer73 | frameshift | Exon 1 of 8 | NP_001394345.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TGFBR1 | ENST00000374994.9 | TSL:1 MANE Select | c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT | p.Pro10GlyfsTer73 | frameshift | Exon 1 of 9 | ENSP00000364133.4 | P36897-1 | |
| TGFBR1 | ENST00000552516.5 | TSL:1 | c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT | p.Pro10GlyfsTer73 | frameshift | Exon 1 of 9 | ENSP00000447297.1 | P36897-2 | |
| TGFBR1 | ENST00000374990.6 | TSL:1 | c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT | p.Pro10GlyfsTer73 | frameshift | Exon 1 of 8 | ENSP00000364129.2 | P36897-3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 30
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at