NM_004612.4:c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT

Variant names:

• chr9-99105206-A-ATGGAGGCGGCGGTCGCTGCTCCGCG
• NM_004612.4:c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_004612.4(TGFBR1):​c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT​(p.Pro10GlyfsTer73) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: TGFBR1 NM_004612.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: -0.334
• Publications: 0 publications found

Genes affected

TGFBR1 (HGNC:11772): (transforming growth factor beta receptor 1) The protein encoded by this gene forms a heteromeric complex with type II TGF-beta receptors when bound to TGF-beta, transducing the TGF-beta signal from the cell surface to the cytoplasm. The encoded protein is a serine/threonine protein kinase. Mutations in this gene have been associated with Loeys-Dietz aortic aneurysm syndrome (LDAS). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]

TGFBR1 Gene-Disease associations (from GenCC):

• familial thoracic aortic aneurysm and aortic dissection

  Inheritance: AD, Unknown Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• Loeys-Dietz syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• Loeys-Dietz syndrome 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
• multiple self-healing squamous epithelioma

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: G2P, ClinGen, Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 119 pathogenic variants in the truncated region.
• PP5: Variant 9-99105206-A-ATGGAGGCGGCGGTCGCTGCTCCGCG is Pathogenic according to our data. Variant chr9-99105206-A-ATGGAGGCGGCGGTCGCTGCTCCGCG is described in ClinVar as Pathogenic. ClinVar VariationId is 2748941.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004612.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TGFBR1	NM_004612.4	MANE Select	c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT	p.Pro10GlyfsTer73	frameshift	Exon 1 of 9	NP_004603.1	P36897-1
	TGFBR1	NM_001306210.2		c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT	p.Pro10GlyfsTer73	frameshift	Exon 1 of 9	NP_001293139.1	P36897-2
	TGFBR1	NM_001407416.1		c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT	p.Pro10GlyfsTer73	frameshift	Exon 1 of 8	NP_001394345.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TGFBR1	ENST00000374994.9	TSL:1 MANE Select	c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT	p.Pro10GlyfsTer73	frameshift	Exon 1 of 9	ENSP00000364133.4	P36897-1
	TGFBR1	ENST00000552516.5	TSL:1	c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT	p.Pro10GlyfsTer73	frameshift	Exon 1 of 9	ENSP00000447297.1	P36897-2
	TGFBR1	ENST00000374990.6	TSL:1	c.3_27dupGGAGGCGGCGGTCGCTGCTCCGCGT	p.Pro10GlyfsTer73	frameshift	Exon 1 of 8	ENSP00000364129.2	P36897-3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Familial thoracic aortic aneurysm and aortic dissection (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.33
Mutation Taster		=17/183	disease causing

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr9-101867488;