ENST00000430249:c.-56_-36dupGGAAATGTAGTTGCTTTCTTA

Variant names:

• chr2-210477693-A-ATAGTTGCTTTCTTAGGAAATG
• rs1375135144
• ENST00000430249.7:c.-56_-36dupGGAAATGTAGTTGCTTTCTTA

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The ENST00000430249.7(CPS1):​c.-56_-36dupGGAAATGTAGTTGCTTTCTTA variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000131 in 1,600,460 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000013 (0 hom.)
• Consequence: CPS1 ENST00000430249.7 5_prime_UTR
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: -0.195
• Publications: 0 publications found

Genes affected

CPS1 (HGNC:2323): (carbamoyl-phosphate synthase 1) The mitochondrial enzyme encoded by this gene catalyzes synthesis of carbamoyl phosphate from ammonia and bicarbonate. This reaction is the first committed step of the urea cycle, which is important in the removal of excess urea from cells. The encoded protein may also represent a core mitochondrial nucleoid protein. Three transcript variants encoding different isoforms have been found for this gene. The shortest isoform may not be localized to the mitochondrion. Mutations in this gene have been associated with carbamoyl phosphate synthetase deficiency, susceptibility to persistent pulmonary hypertension, and susceptibility to venoocclusive disease after bone marrow transplantation.[provided by RefSeq, May 2010]

LANCL1 (HGNC:6508): (LanC like glutathione S-transferase 1) This gene encodes a loosely associated peripheral membrane protein related to the LanC family of bacterial membrane-associated proteins involved in the biosynthesis of antimicrobial peptides. This protein may play a role as a peptide-modifying enzyme component in eukaryotic cells. Previously considered a member of the G-protein-coupled receptor superfamily, this protein is now in the LanC family. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2008]

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP6: Variant 2-210477693-A-ATAGTTGCTTTCTTAGGAAATG is Benign according to our data. Variant chr2-210477693-A-ATAGTTGCTTTCTTAGGAAATG is described in ClinVar as Likely_benign. ClinVar VariationId is 506407.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000430249.7. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CPS1	NM_001122633.3		c.-74_-54dupGGAAATGTAGTTGCTTTCTTA		5_prime_UTR	Exon 1 of 39	NP_001116105.2	P31327-1
	CPS1	NM_001369257.1		c.-194_-174dupGGAAATGTAGTTGCTTTCTTA		5_prime_UTR	Exon 1 of 40	NP_001356186.1	P31327-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CPS1	ENST00000430249.7	TSL:1	c.-56_-36dupGGAAATGTAGTTGCTTTCTTA		5_prime_UTR	Exon 1 of 39	ENSP00000402608.2	P31327-3
	CPS1	ENST00000673510.1		c.-194_-174dupGGAAATGTAGTTGCTTTCTTA		5_prime_UTR	Exon 1 of 40	ENSP00000500537.1	P31327-1
	CPS1	ENST00000673630.1		c.-308_-288dupGGAAATGTAGTTGCTTTCTTA		5_prime_UTR	Exon 1 of 40	ENSP00000501073.1	P31327-1

Frequencies

GnomAD3 genomes AF: 0.0000131 AC: 2 AN: 152126 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000483

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000131 AC: 19 AN: 1448334 Hom.: 0 Cov.: 27 AF XY: 0.00000556 AC XY: 4 AN XY: 719884

African (AFR) AF: 0.000150 AC: 5 AN: 33262

American (AMR) AF: 0.0000231 AC: 1 AN: 43304

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25738

East Asian (EAS) AF: 0.00 AC: 0 AN: 39602

South Asian (SAS) AF: 0.00 AC: 0 AN: 83834

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52970

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5742

European-Non Finnish (NFE) AF: 0.0000109 AC: 12 AN: 1103958

Other (OTH) AF: 0.0000167 AC: 1 AN: 59924

GnomAD4 genome AF: 0.0000131 AC: 2 AN: 152126 Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1 AN XY: 74300

African (AFR) AF: 0.0000483 AC: 2 AN: 41422

American (AMR) AF: 0.00 AC: 0 AN: 15270

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3466

East Asian (EAS) AF: 0.00 AC: 0 AN: 5192

South Asian (SAS) AF: 0.00 AC: 0 AN: 4828

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10598

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68032

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.20

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1375135144; hg19: chr2-211342417;