ENST00000530902.5:n.141_167dupAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant names:

• chr5-146878727-A-AGCTGCTGCTGCTGCTGCTGCTGCTGCT
• rs10591869
• ENST00000530902.5:n.141_167dupAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Likely benign. The variant received -6 ACMG points: 0P and 6B. BP6_Moderate BS2

The ENST00000530902.5(PPP2R2B):​n.141_167dupAGCAGCAGCAGCAGCAGCAGCAGCAGC variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.0047 (7 hom., cov: 0)
  • Exomes 𝑓: 0.0017 (101 hom.)
  • Failed GnomAD Quality Control
• Consequence: PPP2R2B ENST00000530902.5 non_coding_transcript_exon
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 3.19
• Publications: 4 publications found

Genes affected

PPP2R2B (HGNC:9305): (protein phosphatase 2 regulatory subunit Bbeta) The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5' UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 55-78 copies in cases of SCA12. [provided by RefSeq, Jul 2016]

PPP2R2B Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 12

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_benign. The variant received -6 ACMG points.

• BP6: Variant 5-146878727-A-AGCTGCTGCTGCTGCTGCTGCTGCTGCT is Benign according to our data. Variant chr5-146878727-A-AGCTGCTGCTGCTGCTGCTGCTGCTGCT is described in ClinVar as [Likely_benign]. Clinvar id is 2655889.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High AC in GnomAd4 at 707 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PPP2R2B	NM_181675.4	c.-288_-262dupAGCAGCAGCAGCAGCAGCAGCAGCAGC		5_prime_UTR_variant	Exon 1 of 10	ENST00000394411.9	NP_858061.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PPP2R2B	ENST00000394411.9	c.-288_-262dupAGCAGCAGCAGCAGCAGCAGCAGCAGC		5_prime_UTR_variant	Exon 1 of 10	2	NM_181675.4	ENSP00000377933.3

Frequencies

GnomAD3 genomes AF: 0.00471 AC: 709 AN: 150482 Hom.: 7 Cov.: 0

Gnomad AFR AF: 0.0128

Gnomad AMI AF: 0.00222

Gnomad AMR AF: 0.00205

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00386

Gnomad SAS AF: 0.00978

Gnomad FIN AF: 0.00125

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00103

Gnomad OTH AF: 0.00290

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00172 AC: 1968 AN: 1146160 Hom.: 101 Cov.: 27 AF XY: 0.00191 AC XY: 1072 AN XY: 561678

African (AFR) AF: 0.0105 AC: 245 AN: 23412

American (AMR) AF: 0.00133 AC: 36 AN: 27146

Ashkenazi Jewish (ASJ) AF: 0.000590 AC: 9 AN: 15244

East Asian (EAS) AF: 0.00799 AC: 190 AN: 23786

South Asian (SAS) AF: 0.00680 AC: 493 AN: 72508

European-Finnish (FIN) AF: 0.0198 AC: 299 AN: 15108

Middle Eastern (MID) AF: 0.00528 AC: 15 AN: 2840

European-Non Finnish (NFE) AF: 0.000595 AC: 549 AN: 923244

Other (OTH) AF: 0.00308 AC: 132 AN: 42872

GnomAD4 genome AF: 0.00469 AC: 707 AN: 150600 Hom.: 7 Cov.: 0 AF XY: 0.00485 AC XY: 356 AN XY: 73472

African (AFR) AF: 0.0127 AC: 522 AN: 41002

American (AMR) AF: 0.00204 AC: 31 AN: 15176

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3460

East Asian (EAS) AF: 0.00387 AC: 19 AN: 4910

South Asian (SAS) AF: 0.00937 AC: 44 AN: 4698

European-Finnish (FIN) AF: 0.00125 AC: 13 AN: 10440

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.00103 AC: 70 AN: 67634

Other (OTH) AF: 0.00287 AC: 6 AN: 2088

Alfa AF: 0.00 Hom.: 47

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

May 01, 2025

CeGaT Center for Human Genetics Tuebingen

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

PPP2R2B: BS1 -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.2
Mutation Taster		=300/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs10591869; hg19: chr5-146258290;