ENST00000706918.1:c.184_213delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr15-89333596-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-T
• rs41550117
• ENST00000706918.1:c.184_213delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 4P and 2B. PM1 PM2 BP3 BP6

The ENST00000706918.1(POLGARF):​c.184_213delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Ala62_Ala71del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000033 in 151,604 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. A62A) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000033 (0 hom., cov: 30)
  • Exomes 𝑓: 0.000016 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: POLGARF ENST00000706918.1 conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:1
• Conservation: PhyloP100: 0.0750

Genes affected

POLGARF (HGNC:56246): (POLG alternative reading frame) This gene uses the same transcript as the POLG gene but has a CUG start codon and an alternate reading frame that makes a 260 aa protein. This protein is distinct from POLG isoforms and may interact with P32 (also known as C1QBP), a mitochondrial matrix protein thought to be involved in the expression of mitochondrial genome-encoded proteins. POLGARF protein may bind P32 and sequester it in the nucleolus. Interestingly, some disease-causing mutations thought to be in POLG may instead be associated with POLGARF. [provided by RefSeq, May 2022]

POLG (HGNC:9179): (DNA polymerase gamma, catalytic subunit) Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM1: In a hotspot region, there are 3 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 11 benign, 12 uncertain in ENST00000706918.1
• PM2: Very rare variant in population databases, with high coverage
• BP3: Nonframeshift variant in repetitive region in ENST00000706918.1
• BP6: Variant 15-89333596-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-T is Benign according to our data. Variant chr15-89333596-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-T is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 619491.We mark this variant Likely_benign, oryginal submissions are: {Uncertain_significance=1, Benign=1}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
POLG	NM_002693.3	c.129_158delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln44_Gln53del	disruptive_inframe_deletion	Exon 2 of 23	ENST00000268124.11	NP_002684.1
POLGARF	NM_001430120.1	c.184_213delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Ala62_Ala71del	conservative_inframe_deletion	Exon 1 of 2		NP_001417049.1
POLG	NM_001126131.2	c.129_158delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln44_Gln53del	disruptive_inframe_deletion	Exon 2 of 23		NP_001119603.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
POLGARF	ENST00000706918.1	c.184_213delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Ala62_Ala71del	conservative_inframe_deletion	Exon 1 of 2			ENSP00000516626.1
POLG	ENST00000268124.11	c.129_158delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln44_Gln53del	disruptive_inframe_deletion	Exon 2 of 23	1	NM_002693.3	ENSP00000268124.5

Frequencies

GnomAD3 genomes AF: 0.0000330 AC: 5 AN: 151604 Hom.: 0 Cov.: 30

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000737

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000159 AC: 23 AN: 1446396 Hom.: 0 AF XY: 0.0000181 AC XY: 13 AN XY: 719198

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000199

Gnomad4 OTH exome AF: 0.0000167

GnomAD4 genome AF: 0.0000330 AC: 5 AN: 151604 Hom.: 0 Cov.: 30 AF XY: 0.0000270 AC XY: 2 AN XY: 74046

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000737

Gnomad4 OTH AF: 0.00

Bravo AF: 0.0000189

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:1 Benign:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Progressive sclerosing poliodystrophy Uncertain:1 Benign:1

Aug 28, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.129_158del, results in the deletion of 10 amino acid(s) of the POLG protein (p.Gln46_Gln55del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with POLG-related conditions. ClinVar contains an entry for this variant (Variation ID: 619491). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Oct 01, 2018

Wong Mito Lab, Molecular and Human Genetics, Baylor College of Medicine

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The NM_002693.2:c.129_158del (NP_002684.1:p.Gln44_Gln53del) [GRCH38: NC_000015.10:g.89333600_89333629del] variant in POLG gene is interpretated to be a Benign based on ACMG guidelines (PMID: 25741868). This variant meets the following evidence codes reported in the ACMG-guideline. BS1:The minor allele frequency of this allele is high for Mitochondrial DNA depletion syndrome 4A (Alpers type). BS2:Observation of the variant in controls is inconsistent with penetrance of Mitochondrial DNA depletion syndrome 4A (Alpers type). BP3:This variant results in inframe indel in repeats without known function. BP4:Computational evidence/predictors indicate no impact on the POLG structure, function, or protein-protein interaction. Based on the evidence criteria codes applied, the variant is suggested to be Benign. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs41550117; hg19: chr15-89876827;