ENST00000706918.1:c.187_213delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr15-89333596-TTGCTGCTGCTGCTGCTGCTGCTGCTGC-T
• ENST00000706918.1:c.187_213delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 4P and 1B. PM1 PM2 BP3

The ENST00000706918.1(POLGARF):​c.187_213delGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Ala63_Ala71del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. A63A) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 30)
  • Exomes 𝑓: 0.0000048 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: POLGARF ENST00000706918.1 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.0750

Genes affected

POLGARF (HGNC:56246): (POLG alternative reading frame) This gene uses the same transcript as the POLG gene but has a CUG start codon and an alternate reading frame that makes a 260 aa protein. This protein is distinct from POLG isoforms and may interact with P32 (also known as C1QBP), a mitochondrial matrix protein thought to be involved in the expression of mitochondrial genome-encoded proteins. POLGARF protein may bind P32 and sequester it in the nucleolus. Interestingly, some disease-causing mutations thought to be in POLG may instead be associated with POLGARF. [provided by RefSeq, May 2022]

POLG (HGNC:9179): (DNA polymerase gamma, catalytic subunit) Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 3 ACMG points.

• PM1: In a hotspot region, there are 5 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 12 benign, 11 uncertain in ENST00000706918.1
• PM2: Very rare variant in population databases, with high coverage
• BP3: Nonframeshift variant in repetitive region in ENST00000706918.1

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
POLG	NM_002693.3	c.132_158delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln45_Gln53del	disruptive_inframe_deletion	Exon 2 of 23	ENST00000268124.11	NP_002684.1
POLGARF	NM_001430120.1	c.187_213delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Ala63_Ala71del	conservative_inframe_deletion	Exon 1 of 2		NP_001417049.1
POLG	NM_001126131.2	c.132_158delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln45_Gln53del	disruptive_inframe_deletion	Exon 2 of 23		NP_001119603.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
POLGARF	ENST00000706918.1	c.187_213delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Ala63_Ala71del	conservative_inframe_deletion	Exon 1 of 2			ENSP00000516626.1
POLG	ENST00000268124.11	c.132_158delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln45_Gln53del	disruptive_inframe_deletion	Exon 2 of 23	1	NM_002693.3	ENSP00000268124.5

Frequencies

GnomAD3 genomes Cov.: 30

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000484 AC: 7 AN: 1446396 Hom.: 0 AF XY: 0.00000695 AC XY: 5 AN XY: 719198

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000633

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 30

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Jun 05, 2019

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Not observed in large population cohorts (Lek et al., 2016); Has not been previously published as pathogenic or benign to our knowledge -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr15-89876827;