ENST00000706918.1:c.187_213dupGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr15-89333596-T-TTGCTGCTGCTGCTGCTGCTGCTGCTGC
• rs41550117
• ENST00000706918.1:c.187_213dupGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 4P and 1B. PM1 PM2 BP3

The ENST00000706918.1(POLGARF):​c.187_213dupGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Ala63_Ala71dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000033 in 151,604 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. A71A) has been classified as Uncertain significance.

• Frequency:
  • Genomes: 𝑓 0.000033 (0 hom., cov: 30)
  • Exomes 𝑓: 0.0000021 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: POLGARF ENST00000706918.1 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -2.20

Genes affected

POLGARF (HGNC:56246): (POLG alternative reading frame) This gene uses the same transcript as the POLG gene but has a CUG start codon and an alternate reading frame that makes a 260 aa protein. This protein is distinct from POLG isoforms and may interact with P32 (also known as C1QBP), a mitochondrial matrix protein thought to be involved in the expression of mitochondrial genome-encoded proteins. POLGARF protein may bind P32 and sequester it in the nucleolus. Interestingly, some disease-causing mutations thought to be in POLG may instead be associated with POLGARF. [provided by RefSeq, May 2022]

POLG (HGNC:9179): (DNA polymerase gamma, catalytic subunit) Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 3 ACMG points.

• PM1: In a hotspot region, there are 6 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 12 benign, 9 uncertain in ENST00000706918.1
• PM2: Very rare variant in population databases, with high coverage
• BP3: Nonframeshift variant in repetitive region in ENST00000706918.1

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
POLG	NM_002693.3	c.132_158dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln45_Gln53dup	disruptive_inframe_insertion	Exon 2 of 23	ENST00000268124.11	NP_002684.1
POLGARF	NM_001430120.1	c.187_213dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Ala63_Ala71dup	conservative_inframe_insertion	Exon 1 of 2		NP_001417049.1
POLG	NM_001126131.2	c.132_158dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln45_Gln53dup	disruptive_inframe_insertion	Exon 2 of 23		NP_001119603.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
POLGARF	ENST00000706918.1	c.187_213dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Ala63_Ala71dup	conservative_inframe_insertion	Exon 1 of 2			ENSP00000516626.1
POLG	ENST00000268124.11	c.132_158dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln45_Gln53dup	disruptive_inframe_insertion	Exon 2 of 23	1	NM_002693.3	ENSP00000268124.5

Frequencies

GnomAD3 genomes AF: 0.0000330 AC: 5 AN: 151604 Hom.: 0 Cov.: 30

Gnomad AFR AF: 0.000121

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000207 AC: 3 AN: 1446396 Hom.: 0 Cov.: 31 AF XY: 0.00000278 AC XY: 2 AN XY: 719198

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000271

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000330 AC: 5 AN: 151604 Hom.: 0 Cov.: 30 AF XY: 0.0000270 AC XY: 2 AN XY: 74046

Gnomad4 AFR AF: 0.000121

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Progressive sclerosing poliodystrophy Uncertain:1

Jul 30, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.132_158dup, results in the insertion of 9 amino acid(s) of the POLG protein (p.Gln47_Gln55dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with POLG-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs41550117; hg19: chr15-89876827;