NM_000052.7:c.1978_2008dupTTCTGTATTCCTGTAATGGGGCTGATGATAT

Variant names:

• chrX-78011478-T-TTTTCTGTATTCCTGTAATGGGGCTGATGATA
• rs797045343
• NM_000052.7:c.1978_2008dupTTCTGTATTCCTGTAATGGGGCTGATGATAT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000052.7(ATP7A):​c.1978_2008dupTTCTGTATTCCTGTAATGGGGCTGATGATAT​(p.Tyr670PhefsTer25) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. Y670Y) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 22)
• Consequence: ATP7A NM_000052.7 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.626
• Publications: 1 publications found

Genes affected

ATP7A (HGNC:869): (ATPase copper transporting alpha) This gene encodes a transmembrane protein that functions in copper transport across membranes. This protein is localized to the trans Golgi network, where it is predicted to supply copper to copper-dependent enzymes in the secretory pathway. It relocalizes to the plasma membrane under conditions of elevated extracellular copper, and functions in the efflux of copper from cells. Mutations in this gene are associated with Menkes disease, X-linked distal spinal muscular atrophy, and occipital horn syndrome. Alternatively-spliced transcript variants have been observed. [provided by RefSeq, Aug 2013]

PGK1 (HGNC:8896): (phosphoglycerate kinase 1) The protein encoded by this gene is a glycolytic enzyme that catalyzes the conversion of 1,3-diphosphoglycerate to 3-phosphoglycerate. The encoded protein may also act as a cofactor for polymerase alpha. Additionally, this protein is secreted by tumor cells where it participates in angiogenesis by functioning to reduce disulfide bonds in the serine protease, plasmin, which consequently leads to the release of the tumor blood vessel inhibitor angiostatin. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Deficiency of the enzyme is associated with a wide range of clinical phenotypes hemolytic anemia and neurological impairment. Pseudogenes of this gene have been defined on chromosomes 19, 21 and the X chromosome. [provided by RefSeq, Jan 2014]

PGK1 Gene-Disease associations (from GenCC):

• glycogen storage disease due to phosphoglycerate kinase 1 deficiency

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, G2P, Genomics England PanelApp

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant X-78011478-T-TTTTCTGTATTCCTGTAATGGGGCTGATGATA is Pathogenic according to our data. Variant chrX-78011478-T-TTTTCTGTATTCCTGTAATGGGGCTGATGATA is described in ClinVar as Pathogenic. ClinVar VariationId is 210409.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000052.7. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATP7A	NM_000052.7	MANE Select	c.1978_2008dupTTCTGTATTCCTGTAATGGGGCTGATGATAT	p.Tyr670PhefsTer25	frameshift	Exon 9 of 23	NP_000043.4
	ATP7A	NM_001282224.2		c.1978_2008dupTTCTGTATTCCTGTAATGGGGCTGATGATAT	p.Tyr670PhefsTer25	frameshift	Exon 9 of 22	NP_001269153.1
	ATP7A	NR_104109.2		n.285-19920_285-19890dupTTCTGTATTCCTGTAATGGGGCTGATGATAT		intron	N/A

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATP7A	ENST00000341514.11	TSL:1 MANE Select	c.1978_2008dupTTCTGTATTCCTGTAATGGGGCTGATGATAT	p.Tyr670PhefsTer25	frameshift	Exon 9 of 23	ENSP00000345728.6
	ATP7A	ENST00000689767.1		c.2071_2101dupTTCTGTATTCCTGTAATGGGGCTGATGATAT	p.Tyr701PhefsTer25	frameshift	Exon 11 of 25	ENSP00000509406.1
	ATP7A	ENST00000343533.10	TSL:5	c.2008_2038dupTTCTGTATTCCTGTAATGGGGCTGATGATAT	p.Tyr680PhefsTer25	frameshift	Exon 10 of 24	ENSP00000343026.6

Frequencies

GnomAD3 genomes Cov.: 22

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 22

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Menkes kinky-hair syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.63
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs797045343; hg19: chrX-77266975;