NM_000117.3:c.119_150delAGTACGAGACCCAGAGGCGGCGGCTCTCGCCC
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_000117.3(EMD):c.119_150delAGTACGAGACCCAGAGGCGGCGGCTCTCGCCC(p.Glu40AlafsTer10) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000117.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- X-linked Emery-Dreifuss muscular dystrophyInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet
- heart conduction diseaseInheritance: XL Classification: STRONG Submitted by: Genomics England PanelApp
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000117.3. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| EMD | TSL:1 MANE Select | c.119_150delAGTACGAGACCCAGAGGCGGCGGCTCTCGCCC | p.Glu40AlafsTer10 | frameshift | Exon 2 of 6 | ENSP00000358857.4 | P50402 | ||
| EMD | c.119_150delAGTACGAGACCCAGAGGCGGCGGCTCTCGCCC | p.Glu40AlafsTer10 | frameshift | Exon 2 of 6 | ENSP00000603591.1 | ||||
| EMD | c.119_150delAGTACGAGACCCAGAGGCGGCGGCTCTCGCCC | p.Glu40AlafsTer10 | frameshift | Exon 2 of 6 | ENSP00000603592.1 |
Frequencies
GnomAD3 genomes Cov.: 25
GnomAD4 genome Cov.: 25
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.