NM_000179.3:c.4080_*20delATAGACTGACTACATTGGAAGCTT

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4

The NM_000179.3(MSH6):​c.4080_*20delATAGACTGACTACATTGGAAGCTT​(p.Leu1360_Ter1361delins???) variant causes a stop lost, conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 31)

Consequence

MSH6
NM_000179.3 stop_lost, conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 3.74
Variant links:
Genes affected
MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 4 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PM4
Stoplost variant in NM_000179.3 Downstream stopcodon found after 1389 codons.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MSH6NM_000179.3 linkc.4080_*20delATAGACTGACTACATTGGAAGCTT p.Leu1360_Ter1361delins??? stop_lost, conservative_inframe_deletion Exon 10 of 10 ENST00000234420.11 NP_000170.1 P52701-1Q3SWU9
MSH6NM_000179.3 linkc.4080_*20delATAGACTGACTACATTGGAAGCTT 3_prime_UTR_variant Exon 10 of 10 ENST00000234420.11 NP_000170.1 P52701-1Q3SWU9
FBXO11NM_001190274.2 linkc.*1240_*1263delGCTTCCAATGTAGTCAGTCTATAA downstream_gene_variant ENST00000403359.8 NP_001177203.1 Q86XK2-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MSH6ENST00000234420.11 linkc.4080_*20delATAGACTGACTACATTGGAAGCTT p.Leu1360_Ter1361delins??? stop_lost, conservative_inframe_deletion Exon 10 of 10 1 NM_000179.3 ENSP00000234420.5 P52701-1
MSH6ENST00000234420.11 linkc.4080_*20delATAGACTGACTACATTGGAAGCTT 3_prime_UTR_variant Exon 10 of 10 1 NM_000179.3 ENSP00000234420.5 P52701-1
FBXO11ENST00000403359.8 linkc.*1240_*1263delGCTTCCAATGTAGTCAGTCTATAA downstream_gene_variant 1 NM_001190274.2 ENSP00000384823.4 Q86XK2-1

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hereditary cancer-predisposing syndrome Uncertain:1
Aug 30, 2018
Color Diagnostics, LLC DBA Color Health
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs587781746; hg19: chr2-48033993; API