NM_000194.3:c.22_27+28delGTCGTGGTGAGCAGCTCGGCCTGCCGGCCCTGGC

Variant names:

• chrX-134460324-AGCCCTGGCGTCGTGGTGAGCAGCTCGGCCTGCCG-A
• rs2077579380
• NM_000194.3:c.22_27+28delGTCGTGGTGAGCAGCTCGGCCTGCCGGCCCTGGC

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_000194.3(HPRT1):​c.22_27+28delGTCGTGGTGAGCAGCTCGGCCTGCCGGCCCTGGC​(p.Val8_Val9del) variant causes a splice donor, conservative inframe deletion, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 24)
• Consequence: HPRT1 NM_000194.3 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 3.86

Genes affected

HPRT1 (HGNC:5157): (hypoxanthine phosphoribosyltransferase 1) The protein encoded by this gene is a transferase, which catalyzes conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate via transfer of the 5-phosphoribosyl group from 5-phosphoribosyl 1-pyrophosphate. This enzyme plays a central role in the generation of purine nucleotides through the purine salvage pathway. Mutations in this gene result in Lesch-Nyhan syndrome or gout.[provided by RefSeq, Jun 2009]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.2648402 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-134460324-AGCCCTGGCGTCGTGGTGAGCAGCTCGGCCTGCCG-A is Pathogenic according to our data. Variant chrX-134460324-AGCCCTGGCGTCGTGGTGAGCAGCTCGGCCTGCCG-A is described in ClinVar as [Pathogenic]. Clinvar id is 842633.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HPRT1	NM_000194.3	c.22_27+28delGTCGTGGTGAGCAGCTCGGCCTGCCGGCCCTGGC	p.Val8_Val9del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 1 of 9	ENST00000298556.8	NP_000185.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HPRT1	ENST00000298556.8	c.14_27+20delGCCCTGGCGTCGTGGTGAGCAGCTCGGCCTGCCG	p.Ser5IlefsTer26	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 1 of 9	1	NM_000194.3	ENSP00000298556.7
HPRT1	ENST00000462974.5	n.-26_8delGCCCTGGCGTCGTGGTGAGCAGCTCGGCCTGCCG		non_coding_transcript_exon_variant	Exon 1 of 8	3
HPRT1	ENST00000462974.5	n.-26_8delGCCCTGGCGTCGTGGTGAGCAGCTCGGCCTGCCG		upstream_gene_variant		3

Frequencies

GnomAD3 genomes Cov.: 24

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 24

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Lesch-Nyhan syndrome;C0268117:Partial hypoxanthine-guanine phosphoribosyltransferase deficiency Pathogenic:1

Dec 24, 2019

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant disrupts the c.27+5 nucleotide in the HPRT1 gene. Other variant(s) that disrupt this nucleotide have been determined to be pathogenic (PMID: 17027311). This suggests that this nucleotide is clinically-significant, and that variants that disrupt this position are likely to be disease-causing. Loss-of-function variants in HPRT1 are known to be pathogenic (PMID: 15571220, 17027311, 22157001). For these reasons, this variant has been classified as Pathogenic. This variant results in the deletion of part of exon 1 (c.22_27+28del) of the HPRT1 gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. This variant has not been reported in the literature in individuals with HPRT1-related conditions. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs2077579380; hg19: chrX-133594354;