NM_000232.5:c.-10_22delGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGG
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PS1_Moderate
The NM_000232.5(SGCB):c.-10_22delGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGG(p.Ala2fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000628 in 1,114,206 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. The gene SGCB is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000232.5 frameshift, start_lost
Scores
Clinical Significance
Conservation
Publications
- autosomal recessive limb-girdle muscular dystrophyInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, PanelApp Australia
- autosomal recessive limb-girdle muscular dystrophy type 2EInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Myriad Women's Health, Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000232.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SGCB | MANE Select | c.-10_22delGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGG | p.Ala2fs | frameshift start_lost | Exon 1 of 6 | NP_000223.1 | Q5U0N0 | ||
| SGCB | MANE Select | c.-10_22delGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGG | 5_prime_UTR | Exon 1 of 6 | NP_000223.1 | Q5U0N0 | |||
| SGCB | c.-10_22delGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGG | p.Ala2fs | frameshift start_lost | Exon 1 of 5 | NP_001427448.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SGCB | TSL:1 MANE Select | c.-10_22delGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGG | p.Ala2fs | frameshift start_lost | Exon 1 of 6 | ENSP00000370839.6 | Q16585-1 | ||
| SGCB | TSL:1 MANE Select | c.-10_22delGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGG | 5_prime_UTR | Exon 1 of 6 | ENSP00000370839.6 | Q16585-1 | |||
| SGCB | c.-10_22delGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGG | p.Ala2fs | frameshift start_lost | Exon 1 of 6 | ENSP00000569725.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome AF: 0.00000628 AC: 7AN: 1114206Hom.: 0 AF XY: 0.00000373 AC XY: 2AN XY: 536468 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.