NM_000260.4:c.3924+15_3924+46dupAAGCACCTCCTCCCGGAAGCACCTCCTCCCGG

Variant names:

• chr11-77190879-G-GCCCGGAAGCACCTCCTCCCGGAAGCACCTCCT
• NM_000260.4:c.3924+15_3924+46dupAAGCACCTCCTCCCGGAAGCACCTCCTCCCGG

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM2 BP6_Moderate

The NM_000260.4(MYO7A):​c.3924+15_3924+46dupAAGCACCTCCTCCCGGAAGCACCTCCTCCCGG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely benign (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MYO7A NM_000260.4 intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.0760

Genes affected

MYO7A (HGNC:7606): (myosin VIIA) This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP6: Variant 11-77190879-G-GCCCGGAAGCACCTCCTCCCGGAAGCACCTCCT is Benign according to our data. Variant chr11-77190879-G-GCCCGGAAGCACCTCCTCCCGGAAGCACCTCCT is described in ClinVar as [Likely_benign]. Clinvar id is 2034655.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MYO7A	NM_000260.4	c.3924+15_3924+46dupAAGCACCTCCTCCCGGAAGCACCTCCTCCCGG		intron_variant	Intron 30 of 48	ENST00000409709.9	NP_000251.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MYO7A	ENST00000409709.9	c.3924+15_3924+46dupAAGCACCTCCTCCCGGAAGCACCTCCTCCCGG		intron_variant	Intron 30 of 48	1	NM_000260.4	ENSP00000386331.3
MYO7A	ENST00000458637.6	c.3924+15_3924+46dupAAGCACCTCCTCCCGGAAGCACCTCCTCCCGG		intron_variant	Intron 30 of 48	1		ENSP00000392185.2
MYO7A	ENST00000409619.6	c.3891+15_3891+46dupAAGCACCTCCTCCCGGAAGCACCTCCTCCCGG		intron_variant	Intron 31 of 49	1		ENSP00000386635.2
MYO7A	ENST00000458169.2	c.1467+15_1467+46dupAAGCACCTCCTCCCGGAAGCACCTCCTCCCGG		intron_variant	Intron 10 of 28	1		ENSP00000417017.2
MYO7A	ENST00000670577.1	n.1764+15_1764+46dupAAGCACCTCCTCCCGGAAGCACCTCCTCCCGG		intron_variant	Intron 13 of 31			ENSP00000499323.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Nov 05, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr11-76901924;