NM_000381.4:c.1913_1936delGCCCCACCTTCACCGTGTGGAACAinsTGTTCCACACGGTGAAGGTGGGGC

Variant names:

• chrX-10449436-TGTTCCACACGGTGAAGGTGGGGC-GCCCCACCTTCACCGTGTGGAACA
• NM_000381.4:c.1913_1936delGCCCCACCTTCACCGTGTGGAACAinsTGTTCCACACGGTGAAGGTGGGGC

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 3P and 0B. PM2 PP3

The NM_000381.4(MID1):​c.1913_1936delGCCCCACCTTCACCGTGTGGAACAinsTGTTCCACACGGTGAAGGTGGGGC​(p.CysProThrPheThrValTrpAsnLys638LeuPheHisThrValLysValGlyGln) variant causes a missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 22)
• Consequence: MID1 NM_000381.4 missense
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 8.76

Genes affected

MID1 (HGNC:7095): (midline 1) The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein forms homodimers which associate with microtubules in the cytoplasm. The protein is likely involved in the formation of multiprotein structures acting as anchor points to microtubules. Mutations in this gene have been associated with the X-linked form of Opitz syndrome, which is characterized by midline abnormalities such as cleft lip, laryngeal cleft, heart defects, hypospadias, and agenesis of the corpus callosum. This gene was also the first example of a gene subject to X inactivation in human while escaping it in mouse. Alternative promoter use, alternative splicing and alternative polyadenylation result in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 3 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MID1	NM_000381.4	c.1913_1936delGCCCCACCTTCACCGTGTGGAACAinsTGTTCCACACGGTGAAGGTGGGGC	p.CysProThrPheThrValTrpAsnLys638LeuPheHisThrValLysValGlyGln	missense_variant		ENST00000317552.9	NP_000372.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MID1	ENST00000317552.9	c.1913_1936delGCCCCACCTTCACCGTGTGGAACAinsTGTTCCACACGGTGAAGGTGGGGC	p.CysProThrPheThrValTrpAsnLys638LeuPheHisThrValLysValGlyGln	missense_variant		1	NM_000381.4	ENSP00000312678.4
MID1	ENST00000380782	c.*154_*177delGCCCCACCTTCACCGTGTGGAACAinsTGTTCCACACGGTGAAGGTGGGGC		3_prime_UTR_variant	Exon 10 of 10	1		ENSP00000370159.1

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

X-linked Opitz G/BBB syndrome Uncertain:1

Sep 02, 2022

New York Genome Center

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.1913_1936inv variant in MID1 has not previously been reported in the literature or public variant repositories (ClinVar and LOVD), and is absent from population databases (gnomAD v2.1.1 and v3.1.2, TOPMed Freeze 8, All of Us), suggesting it is not a common benign variant in the populations represented in those databases. The c.1913_1936inv variant is located in exon 10 of this 10-exon gene, and predicted to replace evolutionarily conserved aminoacids in the C-terminal SPRY domain without a change in the protein length (p.(Cys638_Lys646delinsLeuPheHisThrValLysValGlyGln)). In vitro functional studies demonstrated the significance of C-terminal SPRY domain in microtubule binding, however, the specific role of replaced amino acids is not known [PMID: 10077590]. Although missense and truncating variants located in the C-terminal SPRY domain have been reported in individuals with Opitz GBBB syndrome, no individual was reported to carry a variant affecting the replaced amino acids here in the literature. Based on available evidence this inherited heterozygous c.1913_1936inv p.(Cys638_Lys646delinsLeuPheHisThrValLysValGlyGln) variant identified in MID1 in this fetal sample is classified here as Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chrX-10417476;