NM_000527.5:c.667_693delAAGGACAAATCTGACGAGGAAAACTGC

Variant summary

Our verdict is Pathogenic. The variant received 13 ACMG points: 13P and 0B. PM1PM4PP3PP5_Very_Strong

The NM_000527.5(LDLR):​c.667_693delAAGGACAAATCTGACGAGGAAAACTGC​(p.Lys223_Cys231del) variant causes a conservative inframe deletion, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. K223K) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 33)

Consequence

LDLR
NM_000527.5 conservative_inframe_deletion, splice_region

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, multiple submitters, no conflicts P:2

Conservation

PhyloP100: 9.88

Publications

1 publications found
Variant links:
Genes affected
LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]
LDLR Gene-Disease associations (from GenCC):
  • hypercholesterolemia, familial, 1
    Inheritance: AD, SD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, ClinGen
  • homozygous familial hypercholesterolemia
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 13 ACMG points.

PM1
In a hotspot region, there are 50 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 16 uncertain in NM_000527.5
PM4
Nonframeshift variant in NON repetitive region in NM_000527.5.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 19-11105567-GACTGCAAGGACAAATCTGACGAGGAAA-G is Pathogenic according to our data. Variant chr19-11105567-GACTGCAAGGACAAATCTGACGAGGAAA-G is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 251366.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
LDLRNM_000527.5 linkc.667_693delAAGGACAAATCTGACGAGGAAAACTGC p.Lys223_Cys231del conservative_inframe_deletion, splice_region_variant Exon 4 of 18 ENST00000558518.6 NP_000518.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
LDLRENST00000558518.6 linkc.667_693delAAGGACAAATCTGACGAGGAAAACTGC p.Lys223_Cys231del conservative_inframe_deletion, splice_region_variant Exon 4 of 18 1 NM_000527.5 ENSP00000454071.1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Hypercholesterolemia, familial, 1 Pathogenic:2
Mar 25, 2016
LDLR-LOVD, British Heart Foundation
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:literature only

- -

Dec 16, 2016
Centre de Génétique Moléculaire et Chromosomique, Unité de génétique de l'Obésité et des Dyslipidémies, APHP, GH Hôpitaux Universitaires Pitié-Salpêtrière / Charles-Foix
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

subject mutated among 2600 FH index cases screened = 1 -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.9
Mutation Taster
=9/191
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs879254624; hg19: chr19-11216243; API