NM_000548.5:c.4663-38_4663-18dupGGGAGTGATGCCACCCTGCCT
Variant summary
Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_ModerateBS1BS2
The NM_000548.5(TSC2):c.4663-38_4663-18dupGGGAGTGATGCCACCCTGCCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000388 in 1,610,968 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).
Frequency
Consequence
NM_000548.5 intron
Scores
Clinical Significance
Conservation
Publications
- tuberous sclerosisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- tuberous sclerosis 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, Ambry Genetics
- lymphangioleiomyomatosisInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- tuberous sclerosis complexInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000548.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC2 | MANE Select | c.4663-38_4663-18dupGGGAGTGATGCCACCCTGCCT | intron | N/A | NP_000539.2 | P49815-1 | |||
| TSC2 | c.4660-38_4660-18dupGGGAGTGATGCCACCCTGCCT | intron | N/A | NP_001393592.1 | A0A2R8Y6C9 | ||||
| TSC2 | c.4594-38_4594-18dupGGGAGTGATGCCACCCTGCCT | intron | N/A | NP_001107854.1 | P49815-4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC2 | TSL:5 MANE Select | c.4663-39_4663-38insGGGAGTGATGCCACCCTGCCT | intron | N/A | ENSP00000219476.3 | P49815-1 | |||
| TSC2 | TSL:1 | c.4594-39_4594-38insGGGAGTGATGCCACCCTGCCT | intron | N/A | ENSP00000344383.4 | P49815-4 | |||
| TSC2 | TSL:1 | c.4462-39_4462-38insGGGAGTGATGCCACCCTGCCT | intron | N/A | ENSP00000384468.2 | P49815-5 |
Frequencies
GnomAD3 genomes AF: 0.000230 AC: 35AN: 152008Hom.: 0 Cov.: 34 show subpopulations
GnomAD2 exomes AF: 0.000266 AC: 65AN: 244618 AF XY: 0.000307 show subpopulations
GnomAD4 exome AF: 0.000404 AC: 590AN: 1458844Hom.: 0 Cov.: 32 AF XY: 0.000417 AC XY: 303AN XY: 725814 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000230 AC: 35AN: 152124Hom.: 0 Cov.: 34 AF XY: 0.000188 AC XY: 14AN XY: 74364 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at