NM_000835.6:c.3547_3567dupGGGCCTCTGGGGCACAGGGGC

Variant names:

• chr17-74842569-T-TGCCCCTGTGCCCCAGAGGCCC
• rs768223291
• NM_000835.6:c.3547_3567dupGGGCCTCTGGGGCACAGGGGC

Variant summary

Our verdict is Likely benign. The variant received -3 ACMG points: 2P and 5B. PM4 BP6 BS2

The NM_000835.6(GRIN2C):​c.3547_3567dupGGGCCTCTGGGGCACAGGGGC​(p.Gly1189_Arg1190insGlyProLeuGlyHisArgGly) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000293 in 772,044 control chromosomes in the GnomAD database, including 1 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (no stars).

• Frequency:
  • Genomes: 𝑓 0.0010 (0 hom., cov: 34)
  • Exomes 𝑓: 0.00011 (1 hom.)
• Consequence: GRIN2C NM_000835.6 conservative_inframe_insertion
• Clinical Significance: Likely benign no assertion criteria provided B:1
• Conservation: PhyloP100: 0.287
• Publications: 1 publications found

Genes affected

GRIN2C (HGNC:4587): (glutamate ionotropic receptor NMDA type subunit 2C) This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptor, which is a subtype of ionotropic glutamate receptor. NMDA receptors are found in the central nervous system, are permeable to cations and have an important role in physiological processes such as learning, memory, and synaptic development. The receptor is a tetramer of different subunits (typically heterodimer of subunit 1 with one or more of subunits 2A-D), forming a channel that is permeable to calcium, potassium, and sodium, and whose properties are determined by subunit composition. Alterations in the subunit composition of the receptor are associated with pathophysiological conditions such as Parkinson's disease, Alzheimer's disease, depression, and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]

GRIN2C Gene-Disease associations (from GenCC):

• Alzheimer disease

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000835.6.
• BP6: Variant 17-74842569-T-TGCCCCTGTGCCCCAGAGGCCC is Benign according to our data. Variant chr17-74842569-T-TGCCCCTGTGCCCCAGAGGCCC is described in ClinVar as Likely_benign. ClinVar VariationId is 3047243.Status of the report is no_assertion_criteria_provided, 0 stars.
• BS2: High AC in GnomAd4 at 155 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000835.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GRIN2C	NM_000835.6	MANE Select	c.3547_3567dupGGGCCTCTGGGGCACAGGGGC	p.Gly1189_Arg1190insGlyProLeuGlyHisArgGly	conservative_inframe_insertion	Exon 13 of 13	NP_000826.2	Q14957
	GRIN2C	NR_103735.2		n.3700_3720dupGGGCCTCTGGGGCACAGGGGC		non_coding_transcript_exon	Exon 13 of 13

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GRIN2C	ENST00000293190.10	TSL:1 MANE Select	c.3547_3567dupGGGCCTCTGGGGCACAGGGGC	p.Gly1189_Arg1190insGlyProLeuGlyHisArgGly	conservative_inframe_insertion	Exon 13 of 13	ENSP00000293190.5	Q14957
	GRIN2C	ENST00000940919.1		c.3610_3630dupGGGCCTCTGGGGCACAGGGGC	p.Gly1210_Arg1211insGlyProLeuGlyHisArgGly	conservative_inframe_insertion	Exon 14 of 14	ENSP00000610978.1
	GRIN2C	ENST00000940918.1		c.3571_3591dupGGGCCTCTGGGGCACAGGGGC	p.Gly1197_Arg1198insGlyProLeuGlyHisArgGly	conservative_inframe_insertion	Exon 13 of 13	ENSP00000610977.1

Frequencies

GnomAD3 genomes AF: 0.00103 AC: 155 AN: 150088 Hom.: 0 Cov.: 34

Gnomad AFR AF: 0.00372

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000197

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000294

Gnomad OTH AF: 0.00145

GnomAD2 exomes AF: 0.000146 AC: 34 AN: 233334 AF XY: 0.000117

Gnomad AFR exome AF: 0.00230

Gnomad AMR exome AF: 0.0000299

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.0000492

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000114 AC: 71 AN: 621838 Hom.: 1 Cov.: 0 AF XY: 0.0000886 AC XY: 30 AN XY: 338636

African (AFR) AF: 0.00346 AC: 58 AN: 16748

American (AMR) AF: 0.0000465 AC: 2 AN: 43014

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 20844

East Asian (EAS) AF: 0.00 AC: 0 AN: 35860

South Asian (SAS) AF: 0.00 AC: 0 AN: 68992

European-Finnish (FIN) AF: 0.0000194 AC: 1 AN: 51538

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4132

European-Non Finnish (NFE) AF: 0.0000172 AC: 6 AN: 347996

Other (OTH) AF: 0.000122 AC: 4 AN: 32714

GnomAD4 genome AF: 0.00103 AC: 155 AN: 150206 Hom.: 0 Cov.: 34 AF XY: 0.00110 AC XY: 81 AN XY: 73480

African (AFR) AF: 0.00371 AC: 147 AN: 39622

American (AMR) AF: 0.000197 AC: 3 AN: 15210

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5170

South Asian (SAS) AF: 0.00 AC: 0 AN: 4832

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10614

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.0000294 AC: 2 AN: 67990

Other (OTH) AF: 0.00143 AC: 3 AN: 2094

Alfa AF: 0.000927 Hom.: 0

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	-	1	GRIN2C-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.29
Mutation Taster		=75/25	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs768223291; hg19: chr17-72838708;