NM_001018005.2:c.-86_-55delCGCGCTCGCACTCCCGCTCCTCCGCCCGACCG
Variant summary
Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2
The NM_001018005.2(TPM1):c.-86_-55delCGCGCTCGCACTCCCGCTCCTCCGCCCGACCG variant causes a 5 prime UTR change. The variant allele was found at a frequency of 0.0000113 in 1,064,000 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001018005.2 5_prime_UTR
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001018005.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TPM1 | NM_001018005.2 | MANE Select | c.-86_-55delCGCGCTCGCACTCCCGCTCCTCCGCCCGACCG | 5_prime_UTR | Exon 1 of 10 | NP_001018005.1 | D9YZV4 | ||
| TPM1 | NM_001018005.2 | MANE Select | c.-86_-55delCGCGCTCGCACTCCCGCTCCTCCGCCCGACCG | non_coding_transcript | N/A | NP_001018005.1 | D9YZV4 | ||
| TPM1 | NM_001365778.1 | c.-86_-55delCGCGCTCGCACTCCCGCTCCTCCGCCCGACCG | 5_prime_UTR | Exon 1 of 10 | NP_001352707.1 | Q6ZN40 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TPM1 | ENST00000403994.9 | TSL:1 MANE Select | c.-77_-46delACTCCCGCTCCTCCGCCCGACCGCGCGCTCGC | 5_prime_UTR | Exon 1 of 10 | ENSP00000385107.4 | P09493-1 | ||
| TPM1 | ENST00000267996.11 | TSL:1 | c.-77_-46delACTCCCGCTCCTCCGCCCGACCGCGCGCTCGC | 5_prime_UTR | Exon 1 of 9 | ENSP00000267996.7 | P09493-7 | ||
| TPM1 | ENST00000288398.10 | TSL:1 | c.-77_-46delACTCCCGCTCCTCCGCCCGACCGCGCGCTCGC | 5_prime_UTR | Exon 1 of 10 | ENSP00000288398.6 | P09493-10 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152224Hom.: 0 Cov.: 33 show subpopulations
GnomAD4 exome AF: 0.0000121 AC: 11AN: 911776Hom.: 0 AF XY: 0.00000852 AC XY: 4AN XY: 469386 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152224Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0AN XY: 74366 show subpopulations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at