NM_001024630.4:c.231_260dupTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC

Variant names:

• chr6-45422753-G-GGCGGCGGCGGCTGCGGCGGCGGCGGCGGCT
• rs606231174
• NM_001024630.4:c.231_260dupTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 1P and 1B. PP5 BP3

The NM_001024630.4(RUNX2):​c.231_260dupTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC​(p.Ala78_Ala87dup) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 29)
• Consequence: RUNX2 NM_001024630.4 disruptive_inframe_insertion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 4.35
• Publications: 0 publications found

Genes affected

RUNX2 (HGNC:10472): (RUNX family transcription factor 2) This gene is a member of the RUNX family of transcription factors and encodes a nuclear protein with an Runt DNA-binding domain. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Two regions of potential trinucleotide repeat expansions are present in the N-terminal region of the encoded protein, and these and other mutations in this gene have been associated with the bone development disorder cleidocranial dysplasia (CCD). Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Jul 2016]

RUNX2 Gene-Disease associations (from GenCC):

• cleidocranial dysplasia 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, PanelApp Australia, Orphanet
• metaphyseal dysplasia-maxillary hypoplasia-brachydacty syndrome

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

• PP5: Variant 6-45422753-G-GGCGGCGGCGGCTGCGGCGGCGGCGGCGGCT is Pathogenic according to our data. Variant chr6-45422753-G-GGCGGCGGCGGCTGCGGCGGCGGCGGCGGCT is described in ClinVar as Pathogenic. ClinVar VariationId is 9297.Status of the report is no_assertion_criteria_provided, 0 stars.
• BP3: Nonframeshift variant in repetitive region in NM_001024630.4

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001024630.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RUNX2	NM_001024630.4	MANE Select	c.231_260dupTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC	p.Ala78_Ala87dup	disruptive_inframe_insertion	Exon 3 of 9	NP_001019801.3	Q13950-1
	RUNX2	NM_001369405.1		c.189_218dupTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC	p.Ala64_Ala73dup	disruptive_inframe_insertion	Exon 1 of 7	NP_001356334.1	Q13950-2
	RUNX2	NM_001015051.4		c.231_260dupTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC	p.Ala78_Ala87dup	disruptive_inframe_insertion	Exon 3 of 8	NP_001015051.3	Q13950-3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RUNX2	ENST00000647337.2	MANE Select	c.231_260dupTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC	p.Ala78_Ala87dup	disruptive_inframe_insertion	Exon 3 of 9	ENSP00000495497.1	Q13950-1
	RUNX2	ENST00000359524.7	TSL:1	c.189_218dupTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC	p.Ala64_Ala73dup	disruptive_inframe_insertion	Exon 1 of 7	ENSP00000352514.5	Q13950-2
	RUNX2	ENST00000625924.1	TSL:1	c.189_218dupTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC	p.Ala64_Ala73dup	disruptive_inframe_insertion	Exon 1 of 6	ENSP00000485863.1	A0A0D9SEN7

Frequencies

GnomAD3 genomes Cov.: 29

GnomAD4 exome Cov.: 33

GnomAD4 genome Cov.: 29

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Cleidocranial dysplasia 1, forme fruste, with brachydactyly (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.3
Mutation Taster		=75/25	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs606231174; hg19: chr6-45390490;