NM_001032382.2:c.393_413dupAGACCGGGGCCACGACAAGTC
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_001032382.2(PQBP1):c.393_413dupAGACCGGGGCCACGACAAGTC(p.Ser138_Asp139insAspArgGlyHisAspLysSer) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001032382.2 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Renpenning syndromeInheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, ClinGen
- hamel cerebro-palato-cardiac syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked intellectual disability, Golabi-Ito-hall typeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked intellectual disability, Porteous typeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked intellectual disability, Sutherland-Haan typeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| PQBP1 | NM_001032382.2 | c.393_413dupAGACCGGGGCCACGACAAGTC | p.Ser138_Asp139insAspArgGlyHisAspLysSer | disruptive_inframe_insertion | Exon 5 of 7 | ENST00000447146.7 | NP_001027554.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| PQBP1 | ENST00000447146.7 | c.393_413dupAGACCGGGGCCACGACAAGTC | p.Ser138_Asp139insAspArgGlyHisAspLysSer | disruptive_inframe_insertion | Exon 5 of 7 | 1 | NM_001032382.2 | ENSP00000391759.2 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 9.11e-7 AC: 1AN: 1098036Hom.: 0 Cov.: 35 AF XY: 0.00000275 AC XY: 1AN XY: 363406 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 22
ClinVar
Submissions by phenotype
not provided Uncertain:1
This variant, c.393_413dup, results in the insertion of 7 amino acid(s) of the PQBP1 protein (p.Gly134_Arg140dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with PQBP1-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at