NM_001083962.2:c.73-822_73-802delGCTGCTGCTGCTGCTGCTGCT

Variant names:

• chr18-55586153-GAGCAGCAGCAGCAGCAGCAGC-G
• rs55725917
• NM_001083962.2:c.73-822_73-802delGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1 BS2

The NM_001083962.2(TCF4):​c.73-822_73-802delGCTGCTGCTGCTGCTGCTGCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0108 in 572,138 control chromosomes in the GnomAD database, including 504 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.020 (50 hom., cov: 0)
  • Exomes 𝑓: 0.011 (504 hom.)
  • Failed GnomAD Quality Control
• Consequence: TCF4 NM_001083962.2 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.885
• Publications: 0 publications found

Genes affected

TCF4 (HGNC:11634): (transcription factor 4) This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]

TCF4 Gene-Disease associations (from GenCC):

• Pitt-Hopkins syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, PanelApp Australia, Orphanet, Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae)
• corneal dystrophy, Fuchs endothelial, 3

  Inheritance: AD Classification: STRONG Submitted by: G2P
• autosomal dominant non-syndromic intellectual disability

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Fuchs' endothelial dystrophy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autism spectrum disorder

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• intellectual disability

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BS1: Variant frequency is greater than expected in population afr. GnomAdExome4 allele frequency = 0.0108 (6201/572138) while in subpopulation AFR AF = 0.0262 (471/17976). AF 95% confidence interval is 0.0242. There are 504 homozygotes in GnomAdExome4. There are 3180 alleles in the male GnomAdExome4 subpopulation. This position passed quality control check.
• BS2: High AC in GnomAdExome4 at 6201 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001083962.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TCF4	NM_001083962.2	MANE Select	c.73-822_73-802delGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001077431.1	P15884-3
	TCF4	NM_001243226.3		c.379-822_379-802delGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001230155.2	E9PH57
	TCF4	NM_001243228.2		c.73-822_73-802delGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001230157.1	H3BTP3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TCF4	ENST00000354452.8	TSL:5 MANE Select	c.73-822_73-802delGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000346440.3	P15884-3
	TCF4	ENST00000398339.5	TSL:1	c.379-822_379-802delGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000381382.1	E9PH57
	TCF4	ENST00000356073.8	TSL:1	c.73-822_73-802delGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000348374.4	P15884-1

Frequencies

GnomAD3 genomes AF: 0.0199 AC: 2699 AN: 135394 Hom.: 49 Cov.: 0

Gnomad AFR AF: 0.0371

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00882

Gnomad ASJ AF: 0.00819

Gnomad EAS AF: 0.00319

Gnomad SAS AF: 0.00451

Gnomad FIN AF: 0.00789

Gnomad MID AF: 0.00658

Gnomad NFE AF: 0.0168

Gnomad OTH AF: 0.0178

GnomAD4 exome AF: 0.0108 AC: 6201 AN: 572138 Hom.: 504 AF XY: 0.0106 AC XY: 3180 AN XY: 298920

African (AFR) AF: 0.0262 AC: 471 AN: 17976

American (AMR) AF: 0.00668 AC: 147 AN: 22000

Ashkenazi Jewish (ASJ) AF: 0.00799 AC: 119 AN: 14900

East Asian (EAS) AF: 0.00324 AC: 78 AN: 24078

South Asian (SAS) AF: 0.00397 AC: 211 AN: 53212

European-Finnish (FIN) AF: 0.0143 AC: 333 AN: 23322

Middle Eastern (MID) AF: 0.00740 AC: 18 AN: 2434

European-Non Finnish (NFE) AF: 0.0116 AC: 4499 AN: 386480

Other (OTH) AF: 0.0117 AC: 325 AN: 27736

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0200 AC: 2707 AN: 135486 Hom.: 50 Cov.: 0 AF XY: 0.0189 AC XY: 1240 AN XY: 65524

African (AFR) AF: 0.0371 AC: 1397 AN: 37630

American (AMR) AF: 0.00881 AC: 114 AN: 12940

Ashkenazi Jewish (ASJ) AF: 0.00819 AC: 26 AN: 3176

East Asian (EAS) AF: 0.00319 AC: 14 AN: 4382

South Asian (SAS) AF: 0.00451 AC: 18 AN: 3988

European-Finnish (FIN) AF: 0.00789 AC: 72 AN: 9124

Middle Eastern (MID) AF: 0.00709 AC: 2 AN: 282

European-Non Finnish (NFE) AF: 0.0168 AC: 1027 AN: 61250

Other (OTH) AF: 0.0197 AC: 37 AN: 1876

Alfa AF: 0.0191 Hom.: 287

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.89
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs55725917; hg19: chr18-53253384; COSMIC: COSV61892758; COSMIC: COSV61892758;