NM_001083962.2:c.73-825_73-802dupGCTGCTGCTGCTGCTGCTGCTGCT

Variant names:

• chr18-55586153-G-GAGCAGCAGCAGCAGCAGCAGCAGC
• rs55725917
• NM_001083962.2:c.73-825_73-802dupGCTGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1 BS2

The NM_001083962.2(TCF4):​c.73-825_73-802dupGCTGCTGCTGCTGCTGCTGCTGCT variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0054 (23 hom., cov: 0)
  • Exomes 𝑓: 0.0050 (84 hom.)
  • Failed GnomAD Quality Control
• Consequence: TCF4 NM_001083962.2 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.00
• Publications: 0 publications found

Genes affected

TCF4 (HGNC:11634): (transcription factor 4) This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]

TCF4 Gene-Disease associations (from GenCC):

• Pitt-Hopkins syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, PanelApp Australia, Orphanet, Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae)
• corneal dystrophy, Fuchs endothelial, 3

  Inheritance: AD Classification: STRONG Submitted by: G2P
• autosomal dominant non-syndromic intellectual disability

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Fuchs' endothelial dystrophy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autism spectrum disorder

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• intellectual disability

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BS1: Variant frequency is greater than expected in population nfe. GnomAd4 allele frequency = 0.00537 (728/135510) while in subpopulation NFE AF = 0.00501 (307/61252). AF 95% confidence interval is 0.00455. There are 23 homozygotes in GnomAd4. There are 325 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High AC in GnomAd4 at 728 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001083962.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TCF4	NM_001083962.2	MANE Select	c.73-825_73-802dupGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001077431.1	P15884-3
	TCF4	NM_001243226.3		c.379-825_379-802dupGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001230155.2	E9PH57
	TCF4	NM_001243228.2		c.73-825_73-802dupGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001230157.1	H3BTP3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TCF4	ENST00000354452.8	TSL:5 MANE Select	c.73-825_73-802dupGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000346440.3	P15884-3
	TCF4	ENST00000398339.5	TSL:1	c.379-825_379-802dupGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000381382.1	E9PH57
	TCF4	ENST00000356073.8	TSL:1	c.73-825_73-802dupGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000348374.4	P15884-1

Frequencies

GnomAD3 genomes AF: 0.00538 AC: 729 AN: 135418 Hom.: 23 Cov.: 0

Gnomad AFR AF: 0.00288

Gnomad AMI AF: 0.139

Gnomad AMR AF: 0.00278

Gnomad ASJ AF: 0.0252

Gnomad EAS AF: 0.00205

Gnomad SAS AF: 0.00451

Gnomad FIN AF: 0.00471

Gnomad MID AF: 0.00658

Gnomad NFE AF: 0.00501

Gnomad OTH AF: 0.00539

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00495 AC: 2834 AN: 572170 Hom.: 84 Cov.: 0 AF XY: 0.00495 AC XY: 1480 AN XY: 298934

African (AFR) AF: 0.00211 AC: 38 AN: 18016

American (AMR) AF: 0.00327 AC: 72 AN: 21986

Ashkenazi Jewish (ASJ) AF: 0.0233 AC: 347 AN: 14874

East Asian (EAS) AF: 0.00706 AC: 170 AN: 24074

South Asian (SAS) AF: 0.00425 AC: 226 AN: 53164

European-Finnish (FIN) AF: 0.00985 AC: 230 AN: 23346

Middle Eastern (MID) AF: 0.00411 AC: 10 AN: 2436

European-Non Finnish (NFE) AF: 0.00397 AC: 1535 AN: 386534

Other (OTH) AF: 0.00743 AC: 206 AN: 27740

GnomAD4 genome AF: 0.00537 AC: 728 AN: 135510 Hom.: 23 Cov.: 0 AF XY: 0.00496 AC XY: 325 AN XY: 65546

African (AFR) AF: 0.00287 AC: 108 AN: 37658

American (AMR) AF: 0.00270 AC: 35 AN: 12942

Ashkenazi Jewish (ASJ) AF: 0.0252 AC: 80 AN: 3176

East Asian (EAS) AF: 0.00205 AC: 9 AN: 4380

South Asian (SAS) AF: 0.00451 AC: 18 AN: 3988

European-Finnish (FIN) AF: 0.00471 AC: 43 AN: 9120

Middle Eastern (MID) AF: 0.00709 AC: 2 AN: 282

European-Non Finnish (NFE) AF: 0.00501 AC: 307 AN: 61252

Other (OTH) AF: 0.00533 AC: 10 AN: 1876

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.0
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs55725917; hg19: chr18-53253384;