NM_001083962.2:c.73-843_73-802dupGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant names:

• chr18-55586153-G-GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC
• rs55725917
• NM_001083962.2:c.73-843_73-802dupGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1 BS2

The NM_001083962.2(TCF4):​c.73-843_73-802dupGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00043 (2 hom., cov: 0)
  • Exomes 𝑓: 0.00096 (55 hom.)
  • Failed GnomAD Quality Control
• Consequence: TCF4 NM_001083962.2 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.00
• Publications: 0 publications found

Genes affected

TCF4 (HGNC:11634): (transcription factor 4) This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]

TCF4 Gene-Disease associations (from GenCC):

• Pitt-Hopkins syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, PanelApp Australia, Orphanet, Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae)
• corneal dystrophy, Fuchs endothelial, 3

  Inheritance: AD Classification: STRONG Submitted by: G2P
• autosomal dominant non-syndromic intellectual disability

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Fuchs' endothelial dystrophy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autism spectrum disorder

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• intellectual disability

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BS1: Variant frequency is greater than expected in population sas. GnomAd4 allele frequency = 0.000428 (58/135538) while in subpopulation SAS AF = 0.001 (4/3988). AF 95% confidence interval is 0.000352. There are 2 homozygotes in GnomAd4. There are 35 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High AC in GnomAd4 at 58 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001083962.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TCF4	NM_001083962.2	MANE Select	c.73-843_73-802dupGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001077431.1	P15884-3
	TCF4	NM_001243226.3		c.379-843_379-802dupGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001230155.2	E9PH57
	TCF4	NM_001243228.2		c.73-843_73-802dupGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	NP_001230157.1	H3BTP3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TCF4	ENST00000354452.8	TSL:5 MANE Select	c.73-843_73-802dupGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000346440.3	P15884-3
	TCF4	ENST00000398339.5	TSL:1	c.379-843_379-802dupGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000381382.1	E9PH57
	TCF4	ENST00000356073.8	TSL:1	c.73-843_73-802dupGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT		intron	N/A	ENSP00000348374.4	P15884-1

Frequencies

GnomAD3 genomes AF: 0.000428 AC: 58 AN: 135446 Hom.: 2 Cov.: 0

Gnomad AFR AF: 0.000213

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000464

Gnomad ASJ AF: 0.000945

Gnomad EAS AF: 0.000683

Gnomad SAS AF: 0.00100

Gnomad FIN AF: 0.000329

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000490

Gnomad OTH AF: 0.000539

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000964 AC: 552 AN: 572458 Hom.: 55 Cov.: 0 AF XY: 0.000996 AC XY: 298 AN XY: 299078

African (AFR) AF: 0.000555 AC: 10 AN: 18026

American (AMR) AF: 0.000409 AC: 9 AN: 22006

Ashkenazi Jewish (ASJ) AF: 0.00161 AC: 24 AN: 14906

East Asian (EAS) AF: 0.00166 AC: 40 AN: 24080

South Asian (SAS) AF: 0.00109 AC: 58 AN: 53206

European-Finnish (FIN) AF: 0.000899 AC: 21 AN: 23366

Middle Eastern (MID) AF: 0.00205 AC: 5 AN: 2436

European-Non Finnish (NFE) AF: 0.000910 AC: 352 AN: 386678

Other (OTH) AF: 0.00119 AC: 33 AN: 27754

GnomAD4 genome AF: 0.000428 AC: 58 AN: 135538 Hom.: 2 Cov.: 0 AF XY: 0.000534 AC XY: 35 AN XY: 65548

African (AFR) AF: 0.000212 AC: 8 AN: 37658

American (AMR) AF: 0.000464 AC: 6 AN: 12942

Ashkenazi Jewish (ASJ) AF: 0.000945 AC: 3 AN: 3176

East Asian (EAS) AF: 0.000685 AC: 3 AN: 4382

South Asian (SAS) AF: 0.00100 AC: 4 AN: 3988

European-Finnish (FIN) AF: 0.000329 AC: 3 AN: 9126

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 282

European-Non Finnish (NFE) AF: 0.000490 AC: 30 AN: 61270

Other (OTH) AF: 0.000533 AC: 1 AN: 1876

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs55725917; hg19: chr18-53253384;