NM_001110792.2:c.1198_1233delCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC

Variant names:

• chrX-154030630-TGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGG-T
• rs267608589
• NM_001110792.2:c.1198_1233delCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1 PM4

The NM_001110792.2(MECP2):​c.1198_1233delCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC​(p.Pro400_Pro411del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. P400P) has been classified as Benign.

• Frequency: Genomes: not found (cov: 18)
• Consequence: MECP2 NM_001110792.2 conservative_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 3.50
• Publications: 2 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM1: In a hotspot region, there are 9 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 19 benign, 17 uncertain in NM_001110792.2
• PM4: Nonframeshift variant in NON repetitive region in NM_001110792.2.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001110792.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	NM_001110792.2	MANE Select	c.1198_1233delCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC	p.Pro400_Pro411del	conservative_inframe_deletion	Exon 3 of 3	NP_001104262.1
	MECP2	NM_004992.4	MANE Plus Clinical	c.1162_1197delCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC	p.Pro388_Pro399del	conservative_inframe_deletion	Exon 4 of 4	NP_004983.1
	MECP2	NM_001316337.2		c.883_918delCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC	p.Pro295_Pro306del	conservative_inframe_deletion	Exon 5 of 5	NP_001303266.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	ENST00000453960.7	TSL:1 MANE Select	c.1198_1233delCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC	p.Pro400_Pro411del	conservative_inframe_deletion	Exon 3 of 3	ENSP00000395535.2
	MECP2	ENST00000303391.11	TSL:1 MANE Plus Clinical	c.1162_1197delCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC	p.Pro388_Pro399del	conservative_inframe_deletion	Exon 4 of 4	ENSP00000301948.6
	MECP2	ENST00000630151.3	TSL:5	c.1162_1197delCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC	p.Pro388_Pro399del	conservative_inframe_deletion	Exon 4 of 4	ENSP00000486089.2

Frequencies

GnomAD3 genomes Cov.: 18

GnomAD2 exomes AF: 0.00000571 AC: 1 AN: 175276 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000127

Gnomad OTH exome AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 18

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs267608589; hg19: chrX-153296081;