NM_001110792.2:c.1199_1233delCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC

Variant names:

• chrX-154030630-TGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTG-T
• rs267608589
• NM_001110792.2:c.1199_1233delCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_001110792.2(MECP2):​c.1199_1233delCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC​(p.Pro400HisfsTer5) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P400P) has been classified as Benign.

• Frequency: Genomes: not found (cov: 18)
• Consequence: MECP2 NM_001110792.2 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:6 O:1
• Conservation: PhyloP100: 3.50
• Publications: 2 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 113 pathogenic variants in the truncated region.
• PP5: Variant X-154030630-TGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTG-T is Pathogenic according to our data. Variant chrX-154030630-TGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTG-T is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 143402.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001110792.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	NM_001110792.2	MANE Select	c.1199_1233delCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC	p.Pro400HisfsTer5	frameshift	Exon 3 of 3	NP_001104262.1
	MECP2	NM_004992.4	MANE Plus Clinical	c.1163_1197delCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC	p.Pro388HisfsTer5	frameshift	Exon 4 of 4	NP_004983.1
	MECP2	NM_001316337.2		c.884_918delCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC	p.Pro295HisfsTer5	frameshift	Exon 5 of 5	NP_001303266.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	ENST00000453960.7	TSL:1 MANE Select	c.1199_1233delCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC	p.Pro400HisfsTer5	frameshift	Exon 3 of 3	ENSP00000395535.2
	MECP2	ENST00000303391.11	TSL:1 MANE Plus Clinical	c.1163_1197delCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC	p.Pro388HisfsTer5	frameshift	Exon 4 of 4	ENSP00000301948.6
	MECP2	ENST00000630151.3	TSL:5	c.1163_1197delCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC	p.Pro388HisfsTer5	frameshift	Exon 4 of 4	ENSP00000486089.2

Frequencies

GnomAD3 genomes Cov.: 18

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 18

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:6 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Rett syndrome Pathogenic:3

Aug 07, 2018

Genomic Research Center, Shahid Beheshti University of Medical Sciences

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Nov 01, 2011

RettBASE

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: curation

Mar 13, 2024

Centre for Population Genomics, CPG

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: curation

This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). Has been observed in at least 5 individuals with phenotypes consistent with MECP2-related disease (PS4). PubMed: 10814718‚Äö 15737703‚Äö 16473305‚Äö 21160487, ClinVar Variation ID: 143402 This variant is absent from gnomAD (PM2_Supporting).

not provided Pathogenic:2 Other:1

Oct 16, 2019

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Frameshift variant predicted to result in protein truncation in a gene for which loss-of-function is a known mechanism of disease; Not observed in large population cohorts (Lek et al., 2016); This variant is associated with the following publications: (PMID: 15737703, 10814718, 16473305, 21160487)

RettBASE

Significance: not provided

Review Status: flagged submission

Collection Method: literature only

Sep 13, 2019

ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The MECP2 c.1163_1197del; p.Pro388fs variant (rs267608589), also published as c.1159_1193del, is reported in the literature in multiple individuals affected with classic or atypical Rett syndrome (Fukuda 2005, Hadzsiev 2011, Huppke 2000, Philippe 2006). This variant is absent from general population databases (Exome Variant Server, Genome Aggregation Database), indicating it is not a common polymorphism. This variant causes a frameshift by deleting 35 nucleotides, so it is predicted to result in a truncated protein or mRNA subject to nonsense-mediated decay. Based on available information, this variant is considered to be pathogenic. References: Fukuda T et al. Methyl-CpG binding protein 2 gene (MECP2) variations in Japanese patients with Rett syndrome: pathological mutations and polymorphisms. Brain Dev. 2005 Apr;27(3):211-7. Hadzsiev K et al. Analysis of Hungarian patients with Rett syndrome phenotype for MECP2, CDKL5 and FOXG1 gene mutations. J Hum Genet. 2011 Mar;56(3):183-7 Huppke P et al. Rett syndrome: analysis of MECP2 and clinical characterization of 31 patients. Hum Mol Genet. 2000 May 22;9(9):1369-75. Philippe C et al. Spectrum and distribution of MECP2 mutations in 424 Rett syndrome patients: a molecular update. Eur J Med Genet. 2006 Jan-Feb;49(1):9-18.

Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1

Aug 13, 2021

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.5
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs267608589; hg19: chrX-153296081;