NM_001110792.2:c.1201_1226delCCTCCACCTGAGCCCGAGAGCTCCGA
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_001110792.2(MECP2):c.1201_1226delCCTCCACCTGAGCCCGAGAGCTCCGA(p.Pro401GlyfsTer7) variant causes a frameshift change. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P401P) has been classified as Likely benign.
Frequency
Consequence
NM_001110792.2 frameshift
Scores
Clinical Significance
Conservation
Publications
- chromosome Xq28 duplication syndromeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- Rett syndromeInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
- severe neonatal-onset encephalopathy with microcephalyInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- syndromic X-linked intellectual disability Lubs typeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- atypical Rett syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked intellectual disability-psychosis-macroorchidism syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- systemic lupus erythematosusInheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| MECP2 | NM_001110792.2 | c.1201_1226delCCTCCACCTGAGCCCGAGAGCTCCGA | p.Pro401GlyfsTer7 | frameshift_variant | Exon 3 of 3 | ENST00000453960.7 | NP_001104262.1 | |
| MECP2 | NM_004992.4 | c.1165_1190delCCTCCACCTGAGCCCGAGAGCTCCGA | p.Pro389GlyfsTer7 | frameshift_variant | Exon 4 of 4 | ENST00000303391.11 | NP_004983.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| MECP2 | ENST00000453960.7 | c.1201_1226delCCTCCACCTGAGCCCGAGAGCTCCGA | p.Pro401GlyfsTer7 | frameshift_variant | Exon 3 of 3 | 1 | NM_001110792.2 | ENSP00000395535.2 | ||
| MECP2 | ENST00000303391.11 | c.1165_1190delCCTCCACCTGAGCCCGAGAGCTCCGA | p.Pro389GlyfsTer7 | frameshift_variant | Exon 4 of 4 | 1 | NM_004992.4 | ENSP00000301948.6 |
Frequencies
GnomAD3 genomes Cov.: 17
GnomAD4 genome Cov.: 17
ClinVar
Submissions by phenotype
Rett syndrome Pathogenic:2
Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 2.0, this variant is classified as pathogenic. The following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). This variant is absent from gnomAD (PM2_Supporting). Has been observed in at least 2 individuals with phenotypes consistent with MECP2-related disease (PS4_supporting, PMID: 16473305, 10814719). -
- -
Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1
This variant has been observed in individual(s) with Rett syndrome (PMID: 10814719, 11768391, 16473305, 19914908). ClinVar contains an entry for this variant (Variation ID: 143409). For these reasons, this variant has been classified as Pathogenic. This variant disrupts the C-terminus of the MECP2 protein. Other variant(s) that disrupt this region (p.Gln406*) have been determined to be pathogenic (PMID: 10986043, 14560307, 22476991). This suggests that variants that disrupt this region of the protein are likely to be causative of disease. This variant is not present in population databases (ExAC no frequency). This sequence change results in a premature translational stop signal in the MECP2 gene (p.Pro389Glyfs*7). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 98 amino acids of the MECP2 protein. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at