NM_001110792.2:c.770_795delTCATGGTGATCAAACGCCCCGGCAGG
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_001110792.2(MECP2):c.770_795delTCATGGTGATCAAACGCCCCGGCAGG(p.Val257GlufsTer5) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. V257V) has been classified as Likely benign. The gene MECP2 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_001110792.2 frameshift
Scores
Clinical Significance
Conservation
Publications
- chromosome Xq28 duplication syndromeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- Rett syndromeInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics, Orphanet, G2P
- severe neonatal-onset encephalopathy with microcephalyInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- syndromic X-linked intellectual disability Lubs typeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- atypical Rett syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked intellectual disability-psychosis-macroorchidism syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- systemic lupus erythematosusInheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001110792.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MECP2 | MANE Select | c.770_795delTCATGGTGATCAAACGCCCCGGCAGG | p.Val257GlufsTer5 | frameshift | Exon 3 of 3 | NP_001104262.1 | A0A140VKC4 | ||
| MECP2 | MANE Plus Clinical | c.734_759delTCATGGTGATCAAACGCCCCGGCAGG | p.Val245GlufsTer5 | frameshift | Exon 4 of 4 | NP_004983.1 | D3YJ43 | ||
| MECP2 | c.455_480delTCATGGTGATCAAACGCCCCGGCAGG | p.Val152GlufsTer5 | frameshift | Exon 5 of 5 | NP_001303266.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MECP2 | TSL:1 MANE Select | c.770_795delTCATGGTGATCAAACGCCCCGGCAGG | p.Val257GlufsTer5 | frameshift | Exon 3 of 3 | ENSP00000395535.2 | P51608-2 | ||
| MECP2 | TSL:1 MANE Plus Clinical | c.734_759delTCATGGTGATCAAACGCCCCGGCAGG | p.Val245GlufsTer5 | frameshift | Exon 4 of 4 | ENSP00000301948.6 | P51608-1 | ||
| MECP2 | TSL:5 | c.734_759delTCATGGTGATCAAACGCCCCGGCAGG | p.Val245GlufsTer5 | frameshift | Exon 4 of 4 | ENSP00000486089.2 | P51608-1 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 genome Cov.: 23
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at