NM_001122955.4:c.1361_1386delGACAGCGCCCCACCTGCTCTAGTTCC

Variant names:

• chr11-62690369-AGGAACTAGAGCAGGTGGGGCGCTGTC-A
• rs779154593
• NM_001122955.4:c.1361_1386delGACAGCGCCCCACCTGCTCTAGTTCC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_Moderate PM2 PP5_Very_Strong

The NM_001122955.4(BSCL2):​c.1361_1386delGACAGCGCCCCACCTGCTCTAGTTCC​(p.Arg454LeufsTer16) variant causes a frameshift change. The variant allele was found at a frequency of 0.00000684 in 1,461,756 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000068 (0 hom.)
• Consequence: BSCL2 NM_001122955.4 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 4.89

Genes affected

BSCL2 (HGNC:15832): (BSCL2 lipid droplet biogenesis associated, seipin) This gene encodes the multi-pass transmembrane protein protein seipin. This protein localizes to the endoplasmic reticulum and may be important for lipid droplet morphology. Mutations in this gene have been associated with congenital generalized lipodystrophy type 2 or Berardinelli-Seip syndrome, a rare autosomal recessive disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HNRNPUL2 (heterogeneous nuclear ribonucleoprotein U-like 2).[provided by RefSeq, Mar 2011]

HNRNPUL2-BSCL2 (HGNC:49189): (HNRNPUL2-BSCL2 readthrough (NMD candidate)) This locus represents naturally occurring read-through transcription between the neighboring HNRNPUL2 (heterogeneous nuclear ribonucleoprotein U-like 2) and BSCL2 (Berardinelli-Seip congenital lipodystrophy 2 (seipin)) genes on chromosome 11. The read-through transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is unlikely to produce a protein product. [provided by RefSeq, Mar 2011]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0202 CDS is truncated, and there are 1 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 11-62690369-AGGAACTAGAGCAGGTGGGGCGCTGTC-A is Pathogenic according to our data. Variant chr11-62690369-AGGAACTAGAGCAGGTGGGGCGCTGTC-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 947075.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BSCL2	NM_001122955.4	c.1361_1386delGACAGCGCCCCACCTGCTCTAGTTCC	p.Arg454LeufsTer16	frameshift_variant	Exon 11 of 11	ENST00000360796.10	NP_001116427.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BSCL2	ENST00000360796.10	c.1361_1386delGACAGCGCCCCACCTGCTCTAGTTCC	p.Arg454LeufsTer16	frameshift_variant	Exon 11 of 11	1	NM_001122955.4	ENSP00000354032.5
HNRNPUL2-BSCL2	ENST00000403734.2	n.*1412_*1437delGACAGCGCCCCACCTGCTCTAGTTCC		non_coding_transcript_exon_variant	Exon 24 of 24	2		ENSP00000456010.1
HNRNPUL2-BSCL2	ENST00000403734.2	n.*1412_*1437delGACAGCGCCCCACCTGCTCTAGTTCC		3_prime_UTR_variant	Exon 24 of 24	2		ENSP00000456010.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD3 exomes AF: 0.0000239 AC: 6 AN: 251424 Hom.: 0 AF XY: 0.0000147 AC XY: 2 AN XY: 135892

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000173

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000684 AC: 10 AN: 1461756 Hom.: 0 AF XY: 0.00000550 AC XY: 4 AN XY: 727190

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.000224

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

Alfa AF: 0.0000936 Hom.: 0

Bravo AF: 0.0000189

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Charcot-Marie-Tooth disease type 2 Pathogenic:1

Sep 25, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change results in a frameshift in the BSCL2 gene (p.Arg390Leufs*16). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 9 amino acid(s) of the BSCL2 protein and extend the protein by 6 additional amino acid residues. This variant is present in population databases (rs779154593, gnomAD 0.02%). This variant has not been reported in the literature in individuals affected with BSCL2-related conditions. ClinVar contains an entry for this variant (Variation ID: 947075). This variant disrupts a region of the BSCL2 protein in which other variant(s) (p.Gln391*) have been determined to be pathogenic (PMID: 19226263, 24024128). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Congenital generalized lipodystrophy type 2;C2931276:Hereditary spastic paraplegia 17;C4014700:Severe neurodegenerative syndrome with lipodystrophy;C5436838:Neuronopathy, distal hereditary motor, type 5C Pathogenic:1

Jun 05, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs779154593; hg19: chr11-62457841;