NM_001122955.4:c.1361_1386delGACAGCGCCCCACCTGCTCTAGTTCC

Variant names:

• chr11-62690369-AGGAACTAGAGCAGGTGGGGCGCTGTC-A
• rs779154593
• NM_001122955.4:c.1361_1386delGACAGCGCCCCACCTGCTCTAGTTCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1_Moderate PP5_Very_Strong

The NM_001122955.4(BSCL2):​c.1361_1386delGACAGCGCCCCACCTGCTCTAGTTCC​(p.Arg454LeufsTer16) variant causes a frameshift change. The variant allele was found at a frequency of 0.00000684 in 1,461,756 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000068 (0 hom.)
• Consequence: BSCL2 NM_001122955.4 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 4.89
• Publications: 1 publications found

Genes affected

BSCL2 (HGNC:15832): (BSCL2 lipid droplet biogenesis associated, seipin) This gene encodes the multi-pass transmembrane protein protein seipin. This protein localizes to the endoplasmic reticulum and may be important for lipid droplet morphology. Mutations in this gene have been associated with congenital generalized lipodystrophy type 2 or Berardinelli-Seip syndrome, a rare autosomal recessive disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HNRNPUL2 (heterogeneous nuclear ribonucleoprotein U-like 2).[provided by RefSeq, Mar 2011]

HNRNPUL2-BSCL2 (HGNC:49189): (HNRNPUL2-BSCL2 readthrough (NMD candidate)) This locus represents naturally occurring read-through transcription between the neighboring HNRNPUL2 (heterogeneous nuclear ribonucleoprotein U-like 2) and BSCL2 (Berardinelli-Seip congenital lipodystrophy 2 (seipin)) genes on chromosome 11. The read-through transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is unlikely to produce a protein product. [provided by RefSeq, Mar 2011]

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0202 CDS is truncated, and there are 2 pathogenic variants in the truncated region.
• PP5: Variant 11-62690369-AGGAACTAGAGCAGGTGGGGCGCTGTC-A is Pathogenic according to our data. Variant chr11-62690369-AGGAACTAGAGCAGGTGGGGCGCTGTC-A is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 947075.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001122955.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BSCL2	NM_001122955.4	MANE Select	c.1361_1386delGACAGCGCCCCACCTGCTCTAGTTCC	p.Arg454LeufsTer16	frameshift	Exon 11 of 11	NP_001116427.1	Q96G97-4
	BSCL2	NM_001386027.1		c.1367_1392delGACAGCGCCCCACCTGCTCTAGTTCC	p.Arg456LeufsTer16	frameshift	Exon 12 of 12	NP_001372956.1	J3KQ12
	BSCL2	NM_001386028.1		c.1361_1386delGACAGCGCCCCACCTGCTCTAGTTCC	p.Arg454LeufsTer16	frameshift	Exon 12 of 12	NP_001372957.1	Q96G97-4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BSCL2	ENST00000360796.10	TSL:1 MANE Select	c.1361_1386delGACAGCGCCCCACCTGCTCTAGTTCC	p.Arg454LeufsTer16	frameshift	Exon 11 of 11	ENSP00000354032.5	Q96G97-4
	BSCL2	ENST00000405837.5	TSL:1	c.1367_1392delGACAGCGCCCCACCTGCTCTAGTTCC	p.Arg456LeufsTer16	frameshift	Exon 12 of 12	ENSP00000385332.1	J3KQ12
	BSCL2	ENST00000407022.7	TSL:1	c.1169_1194delGACAGCGCCCCACCTGCTCTAGTTCC	p.Arg390LeufsTer16	frameshift	Exon 11 of 11	ENSP00000384080.3	Q96G97-2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.0000239 AC: 6 AN: 251424 AF XY: 0.0000147

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000173

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000684 AC: 10 AN: 1461756 Hom.: 0 AF XY: 0.00000550 AC XY: 4 AN XY: 727190

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33476

American (AMR) AF: 0.000224 AC: 10 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86252

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53404

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5664

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1112010

Other (OTH) AF: 0.00 AC: 0 AN: 60390

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

Alfa AF: 0.0000936 Hom.: 0

Bravo AF: 0.0000189

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	Charcot-Marie-Tooth disease type 2 (1)
1	-	-	Congenital generalized lipodystrophy type 2;C2931276:Hereditary spastic paraplegia 17;C4014700:Severe neurodegenerative syndrome with lipodystrophy;C5436838:Neuronopathy, distal hereditary motor, type 5C (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.9
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs779154593; hg19: chr11-62457841;