NM_001128164.2:c.603_626dupGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr6-16327684-A-ATGCTGCTGCTGCTGCTGCTGCTGC
• rs193922926
• NM_001128164.2:c.603_626dupGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001128164.2(ATXN1):​c.603_626dupGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln201_Gln208dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00038 (0 hom., cov: 20)
  • Exomes 𝑓: 0.00033 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATXN1 NM_001128164.2 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.106
• Publications: 0 publications found

Genes affected

ATXN1 (HGNC:10548): (ataxin 1) The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the `pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. The function of the ataxins is not known. This locus has been mapped to chromosome 6, and it has been determined that the diseased allele contains 40-83 CAG repeats, compared to 6-39 in the normal allele, and is associated with spinocerebellar ataxia type 1 (SCA1). Alternative splicing results in multiple transcript variants, with one variant encoding multiple distinct proteins, ATXN1 and Alt-ATXN1, due to the use of overlapping alternate reading frames. [provided by RefSeq, Nov 2017]

ATXN1 Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 1

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001128164.2
• BS2: High AC in GnomAd4 at 51 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATXN1	NM_001128164.2	c.603_626dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln201_Gln208dup	disruptive_inframe_insertion	Exon 7 of 8	ENST00000436367.6	NP_001121636.1
ATXN1	NM_000332.4	c.603_626dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln201_Gln208dup	disruptive_inframe_insertion	Exon 8 of 9		NP_000323.2
ATXN1	NM_001357857.2	c.*16_*39dupGCAGCAGCAGCAGCAGCAGCAGCA		3_prime_UTR_variant	Exon 8 of 9		NP_001344786.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATXN1	ENST00000436367.6	c.603_626dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln201_Gln208dup	disruptive_inframe_insertion	Exon 7 of 8	1	NM_001128164.2	ENSP00000416360.1
ATXN1	ENST00000244769.8	c.603_626dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln201_Gln208dup	disruptive_inframe_insertion	Exon 8 of 9	1		ENSP00000244769.3
ATXN1	ENST00000642969.1	c.*16_*39dupGCAGCAGCAGCAGCAGCAGCAGCA		downstream_gene_variant				ENSP00000493530.1

Frequencies

GnomAD3 genomes AF: 0.000379 AC: 51 AN: 134640 Hom.: 0 Cov.: 20

Gnomad AFR AF: 0.000244

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000827

Gnomad ASJ AF: 0.000610

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000102

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000449

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000326 AC: 437 AN: 1338958 Hom.: 0 Cov.: 32 AF XY: 0.000295 AC XY: 196 AN XY: 665218

African (AFR) AF: 0.000226 AC: 6 AN: 26542

American (AMR) AF: 0.000197 AC: 7 AN: 35504

Ashkenazi Jewish (ASJ) AF: 0.00101 AC: 25 AN: 24836

East Asian (EAS) AF: 0.00 AC: 0 AN: 30604

South Asian (SAS) AF: 0.000188 AC: 14 AN: 74454

European-Finnish (FIN) AF: 0.0000746 AC: 3 AN: 40210

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4600

European-Non Finnish (NFE) AF: 0.000348 AC: 364 AN: 1047166

Other (OTH) AF: 0.000327 AC: 18 AN: 55042

GnomAD4 genome AF: 0.000379 AC: 51 AN: 134738 Hom.: 0 Cov.: 20 AF XY: 0.000458 AC XY: 30 AN XY: 65504

African (AFR) AF: 0.000244 AC: 8 AN: 32836

American (AMR) AF: 0.000826 AC: 11 AN: 13312

Ashkenazi Jewish (ASJ) AF: 0.000610 AC: 2 AN: 3278

East Asian (EAS) AF: 0.00 AC: 0 AN: 4028

South Asian (SAS) AF: 0.00 AC: 0 AN: 3956

European-Finnish (FIN) AF: 0.000102 AC: 1 AN: 9816

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 258

European-Non Finnish (NFE) AF: 0.000449 AC: 29 AN: 64556

Other (OTH) AF: 0.00 AC: 0 AN: 1834

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.11
Mutation Taster		=91/9	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193922926; hg19: chr6-16327915;