NM_001130144.3:c.82_105dupCTGCTGCTGCTGCTGCTGCTGCTG
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_001130144.3(LTBP3):c.82_105dupCTGCTGCTGCTGCTGCTGCTGCTG(p.Leu28_Leu35dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000854 in 1,171,094 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001130144.3 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- brachyolmia-amelogenesis imperfecta syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
- geleophysic dysplasia 3Inheritance: AD Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- Acromicric dysplasiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- geleophysic dysplasiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| LTBP3 | NM_001130144.3 | c.82_105dupCTGCTGCTGCTGCTGCTGCTGCTG | p.Leu28_Leu35dup | conservative_inframe_insertion | Exon 1 of 28 | ENST00000301873.11 | NP_001123616.1 | |
| LTBP3 | NM_021070.4 | c.82_105dupCTGCTGCTGCTGCTGCTGCTGCTG | p.Leu28_Leu35dup | conservative_inframe_insertion | Exon 1 of 27 | NP_066548.2 | ||
| LTBP3 | NM_001164266.1 | c.-266_-243dupCTGCTGCTGCTGCTGCTGCTGCTG | 5_prime_UTR_variant | Exon 1 of 27 | NP_001157738.1 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 27
GnomAD4 exome AF: 8.54e-7 AC: 1AN: 1171094Hom.: 0 Cov.: 26 AF XY: 0.00 AC XY: 0AN XY: 572218 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 27
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at