NM_001130144.3:c.85_105delCTGCTGCTGCTGCTGCTGCTG
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_001130144.3(LTBP3):c.85_105delCTGCTGCTGCTGCTGCTGCTG(p.Leu29_Leu35del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000606 in 1,320,256 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001130144.3 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- brachyolmia-amelogenesis imperfecta syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
- geleophysic dysplasia 3Inheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- Acromicric dysplasiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- geleophysic dysplasiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001130144.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LTBP3 | MANE Select | c.85_105delCTGCTGCTGCTGCTGCTGCTG | p.Leu29_Leu35del | conservative_inframe_deletion | Exon 1 of 28 | NP_001123616.1 | Q9NS15-1 | ||
| LTBP3 | c.85_105delCTGCTGCTGCTGCTGCTGCTG | p.Leu29_Leu35del | conservative_inframe_deletion | Exon 1 of 27 | NP_066548.2 | Q9NS15-2 | |||
| LTBP3 | c.-263_-243delCTGCTGCTGCTGCTGCTGCTG | 5_prime_UTR | Exon 1 of 27 | NP_001157738.1 | Q9NS15 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LTBP3 | TSL:2 MANE Select | c.85_105delCTGCTGCTGCTGCTGCTGCTG | p.Leu29_Leu35del | conservative_inframe_deletion | Exon 1 of 28 | ENSP00000301873.5 | Q9NS15-1 | ||
| LTBP3 | TSL:1 | c.85_105delCTGCTGCTGCTGCTGCTGCTG | p.Leu29_Leu35del | conservative_inframe_deletion | Exon 1 of 27 | ENSP00000326647.4 | Q9NS15-2 | ||
| LTBP3 | TSL:1 | n.85_105delCTGCTGCTGCTGCTGCTGCTG | non_coding_transcript_exon | Exon 1 of 27 | ENSP00000432350.1 | E9PRF2 |
Frequencies
GnomAD3 genomes AF: 0.0000134 AC: 2AN: 149162Hom.: 0 Cov.: 27 show subpopulations
GnomAD4 exome AF: 0.00000512 AC: 6AN: 1171094Hom.: 0 AF XY: 0.00000175 AC XY: 1AN XY: 572218 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000134 AC: 2AN: 149162Hom.: 0 Cov.: 27 AF XY: 0.0000137 AC XY: 1AN XY: 72744 show subpopulations
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at