NM_001292063.2:c.54_78delGGGTGAGCAGGCAGCCGAGTCCCTG
Variant summary
Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_StrongPM2
The NM_001292063.2(OTOG):c.54_78delGGGTGAGCAGGCAGCCGAGTCCCTG(p.Trp18CysfsTer194) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000248 in 1,413,482 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001292063.2 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_pathogenic. Variant got 6 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
OTOG | NM_001292063.2 | c.54_78delGGGTGAGCAGGCAGCCGAGTCCCTG | p.Trp18CysfsTer194 | frameshift_variant | Exon 1 of 56 | ENST00000399397.6 | NP_001278992.1 | |
OTOG | NM_001277269.2 | c.54_78delGGGTGAGCAGGCAGCCGAGTCCCTG | p.Trp18CysfsTer21 | frameshift_variant | Exon 1 of 55 | NP_001264198.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
OTOG | ENST00000399397.6 | c.54_78delGGGTGAGCAGGCAGCCGAGTCCCTG | p.Trp18CysfsTer194 | frameshift_variant | Exon 1 of 56 | 5 | NM_001292063.2 | ENSP00000382329.2 | ||
OTOG | ENST00000399391.7 | c.54_78delGGGTGAGCAGGCAGCCGAGTCCCTG | p.Trp18CysfsTer21 | frameshift_variant | Exon 1 of 55 | 5 | ENSP00000382323.2 |
Frequencies
GnomAD3 genomes AF: 0.0000460 AC: 7AN: 152212Hom.: 0 Cov.: 32
GnomAD4 exome AF: 0.0000222 AC: 28AN: 1261270Hom.: 0 AF XY: 0.0000194 AC XY: 12AN XY: 617274
GnomAD4 genome AF: 0.0000460 AC: 7AN: 152212Hom.: 0 Cov.: 32 AF XY: 0.0000538 AC XY: 4AN XY: 74360
ClinVar
Submissions by phenotype
not provided Uncertain:1
Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease; Has not been previously published as pathogenic or benign to our knowledge -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at